KCTD17-potassium channel tetramerisation domain containing 17 Gene View larger

KCTD17-potassium channel tetramerisation domain containing 17 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCTD17-potassium channel tetramerisation domain containing 17 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCTD17-potassium channel tetramerisation domain containing 17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031038
Product type: DNA & cDNA
Ncbi symbol: KCTD17
Origin species: Human
Product name: KCTD17-potassium channel tetramerisation domain containing 17 Gene
Size: 2ug
Accessions: BC031038
Gene id: 79734
Gene description: potassium channel tetramerisation domain containing 17
Synonyms: BTB/POZ domain-containing protein KCTD17; potassium channel tetramerization domain containing 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggatggaggccggggaggcagcgccgccggcgggggcgggcggccgcgccgcaggcggctggggcaagtgggtgcggctcaacgtggggggcacggtgttcctgaccacccggcagacgctgtgcggcgagcagaagtccttcctcagccgcctgtgccagggggaagagctgcagtcggaccgggatgagaccggggcctacctcattgaccgtgaccccacctacttcgggcccatcctgaacttcctccggcatggcaagctggtgctggacaaggacatggctgaggagggggtcctggaggaagccgagttctacaacatcggcccgctgatccgcatcatcaaagaccggatggaagagaaggactacacggtcacccaggtcccacccaagcatgtgtaccgcgtgctgcagtgccaggaggaggagctcacgcaaatggtctcaaccatgtctgatggctggcgcttcgagcagctggtgaacatcggctcgtcctacaactacggcagcgaggaccaggcagagttcctgtgtgtggtgtccaaggagctccacagcaccccaaacgggctgagctcagagtccagccgcaaaaccaagagcacggaggagcagctggaggagcagcagcagcaggaggaggaggtggaggaggtggaggtggaacaggtgcaggtggaggcagatgcacaggagaaagcccagtcatctcaggatcccgctaaccttttctccctcccaccactgcctcctcctccgcttcccgctggaggttcccgtccgcaccctctcagacctgaggctgagcttgcagtgagggcttctcctcggcccctcgcccgcccccagagctgccatccctgctgttacaagccagaggcacccggatgtgaggccccagatcacctccagggacttggggttcccatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - twinfilin, actin-binding protein, homolog 2 (Drosophila)
- twinfilin, actin-binding protein, homolog 2 (Drosophila)
- eukaryotic translation initiation factor 4A, isoform 3
- eukaryotic translation initiation factor 4A, isoform 3

Buy KCTD17-potassium channel tetramerisation domain containing 17 Gene now

Add to cart