Login to display prices
Login to display prices
KCTD17-potassium channel tetramerisation domain containing 17 Gene View larger

KCTD17-potassium channel tetramerisation domain containing 17 Gene

PTXBC031038

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCTD17-potassium channel tetramerisation domain containing 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCTD17-potassium channel tetramerisation domain containing 17 Gene

Proteogenix catalog: PTXBC031038
Ncbi symbol: KCTD17
Product name: KCTD17-potassium channel tetramerisation domain containing 17 Gene
Size: 2ug
Accessions: BC031038
Gene id: 79734
Gene description: potassium channel tetramerisation domain containing 17
Synonyms: BTB/POZ domain-containing protein KCTD17; potassium channel tetramerization domain containing 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggatggaggccggggaggcagcgccgccggcgggggcgggcggccgcgccgcaggcggctggggcaagtgggtgcggctcaacgtggggggcacggtgttcctgaccacccggcagacgctgtgcggcgagcagaagtccttcctcagccgcctgtgccagggggaagagctgcagtcggaccgggatgagaccggggcctacctcattgaccgtgaccccacctacttcgggcccatcctgaacttcctccggcatggcaagctggtgctggacaaggacatggctgaggagggggtcctggaggaagccgagttctacaacatcggcccgctgatccgcatcatcaaagaccggatggaagagaaggactacacggtcacccaggtcccacccaagcatgtgtaccgcgtgctgcagtgccaggaggaggagctcacgcaaatggtctcaaccatgtctgatggctggcgcttcgagcagctggtgaacatcggctcgtcctacaactacggcagcgaggaccaggcagagttcctgtgtgtggtgtccaaggagctccacagcaccccaaacgggctgagctcagagtccagccgcaaaaccaagagcacggaggagcagctggaggagcagcagcagcaggaggaggaggtggaggaggtggaggtggaacaggtgcaggtggaggcagatgcacaggagaaagcccagtcatctcaggatcccgctaaccttttctccctcccaccactgcctcctcctccgcttcccgctggaggttcccgtccgcaccctctcagacctgaggctgagcttgcagtgagggcttctcctcggcccctcgcccgcccccagagctgccatccctgctgttacaagccagaggcacccggatgtgaggccccagatcacctccagggacttggggttcccatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: