Login to display prices
Login to display prices
TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene View larger

TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene

PTXBC003161

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene

Proteogenix catalog: PTXBC003161
Ncbi symbol: TWF2
Product name: TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene
Size: 2ug
Accessions: BC003161
Gene id: 11344
Gene description: twinfilin, actin-binding protein, homolog 2 (Drosophila)
Synonyms: A6RP; A6r; MSTP011; PTK9L; twinfilin-2; A6-related protein; PTK9L protein tyrosine kinase 9-like (A6-related protein); protein tyrosine kinase 9-like (A6-related protein); twinfilin, actin-binding protein, homolog 2; twinfilin-1-like protein; twinfilin actin binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcaccaaacgggcatccacgccacggaagagctgaaggaattctttgccaaggcacgggctggctctgtgcggctcatcaaggttgtgattgaggacgagcagctcgtgctgggtgcctcgcaggagccagtaggccgctgggatcaggactatgacagggccgtgctgccactgctggacgcccagcagccctgctacctgctctaccgcctcgactcacagaatgctcagggcttcgaatggctcttcctcgcctggtcgcctgataactcccccgtgcggctgaagatgctgtacgcggccacgcgggccacagtgaaaaaggagtttggaggtggccacatcaaggatgagctcttcgggactgtgaaggatgacctctcttttgctgggtaccagaaacacctgtcgtcctgtgcggcacctgccccgctgacctcggctgagagagagctccagcagatccgcattaacgaggtgaagacagagatcagtgtggaaagcaagcaccagaccctgcagggcctcgccttccccctgcagcctgaggcccagcgggcactccagcagctcaagcagaaaatggtcaactacatccagatgaagctggacctagagcgggaaaccattgagctggtgcacacagagcccacggatgtggcccagctgccctcccgggtgccccgagatgctgcccgctaccacttcttcctctacaagcacacccatgagggcgacccccttgagtctgtagtgttcatctactccatgccggggtacaagtgcagcatcaaggagcgaatgctctactccagctgcaagagccgcctcctcgactccgtggagcaggacttccatctggagatcgccaagaaaattgagattggcgatggggcagagctgacggcagagttcctctacgacgaggtgcaccccaagcaacacgccttcaagcaggccttcgccaagcccaagggcccagggggcaagcggggccataagcgcctcatccgcggcccgggtgaaaatggggatgacagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: