Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene
PTXBC003161
New product
Data sheet of TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003161 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TWF2 |
| Origin species: | Human |
| Product name: | TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC003161 |
| Gene id: | 11344 |
| Gene description: | twinfilin, actin-binding protein, homolog 2 (Drosophila) |
| Synonyms: | A6RP; A6r; MSTP011; PTK9L; twinfilin-2; A6-related protein; PTK9L protein tyrosine kinase 9-like (A6-related protein); protein tyrosine kinase 9-like (A6-related protein); twinfilin, actin-binding protein, homolog 2; twinfilin-1-like protein; twinfilin actin binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcaccaaacgggcatccacgccacggaagagctgaaggaattctttgccaaggcacgggctggctctgtgcggctcatcaaggttgtgattgaggacgagcagctcgtgctgggtgcctcgcaggagccagtaggccgctgggatcaggactatgacagggccgtgctgccactgctggacgcccagcagccctgctacctgctctaccgcctcgactcacagaatgctcagggcttcgaatggctcttcctcgcctggtcgcctgataactcccccgtgcggctgaagatgctgtacgcggccacgcgggccacagtgaaaaaggagtttggaggtggccacatcaaggatgagctcttcgggactgtgaaggatgacctctcttttgctgggtaccagaaacacctgtcgtcctgtgcggcacctgccccgctgacctcggctgagagagagctccagcagatccgcattaacgaggtgaagacagagatcagtgtggaaagcaagcaccagaccctgcagggcctcgccttccccctgcagcctgaggcccagcgggcactccagcagctcaagcagaaaatggtcaactacatccagatgaagctggacctagagcgggaaaccattgagctggtgcacacagagcccacggatgtggcccagctgccctcccgggtgccccgagatgctgcccgctaccacttcttcctctacaagcacacccatgagggcgacccccttgagtctgtagtgttcatctactccatgccggggtacaagtgcagcatcaaggagcgaatgctctactccagctgcaagagccgcctcctcgactccgtggagcaggacttccatctggagatcgccaagaaaattgagattggcgatggggcagagctgacggcagagttcctctacgacgaggtgcaccccaagcaacacgccttcaagcaggccttcgccaagcccaagggcccagggggcaagcggggccataagcgcctcatccgcggcccgggtgaaaatggggatgacagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 4A, isoform 3 - eukaryotic translation initiation factor 4A, isoform 3 - phosphatidylinositol glycan anchor biosynthesis, class O - general transcription factor IIF, polypeptide 1, 74kDa |