EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene View larger

EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene

PTXBC003662

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003662
Product type: DNA & cDNA
Ncbi symbol: EIF4A3
Origin species: Human
Product name: EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene
Size: 2ug
Accessions: BC003662
Gene id: 9775
Gene description: eukaryotic translation initiation factor 4A, isoform 3
Synonyms: DDX48; MUK34; NMP265; NUK34; RCPS; eIF4AIII; eukaryotic initiation factor 4A-III; ATP-dependent RNA helicase DDX48; ATP-dependent RNA helicase eIF4A-3; DEAD (Asp-Glu-Ala-Asp) box polypeptide 48; DEAD box protein 48; NMP 265; eIF-4A-III; eIF4A-III; eukaryotic initiation factor 4A-like NUK-34; eukaryotic translation initiation factor 4A; hNMP 265; nuclear matrix protein 265; eukaryotic translation initiation factor 4A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccacggccacgatggcgacctcgggctcggcgcgaaagcggctgctcaaagaggaagacatgactaaagtggaattcgagaccagcgaggaggtggatgtgacccccacgttcgacaccatgggcctgcgggaggacctgctgcggggcatctacgcttacggttttgaaaaaccatcagcaatccagcaacgagcaatcaagcagatcatcaaagggagagatgtcatcgcacagtctcagtccggcacaggaaaaacagccaccttcagtatctcagtcctccagtgtttggatattcaggttcgtgaaactcaagctttgatcttggctcccacaagagagttggctgtgcagatccagaaggggctgcttgctctcggtgactacatgaatgtccagtgccatgcctgcattggaggcaccaatgttggcgaggacatcaggaagctggattacggacagcatgttgttgcgggcactccagggcgtgtttttgatatgattcgtcgcagaagcctaaggacacgtgctatcaaaatgttggttttggatgaagctgatgaaatgttgaataaaggtttcaaagagcagatttacgatgtatacaggtacctgcctccagccacacaggtggttctcatcagtgccacgctgccacacgagattctggagatgaccaacaagttcatgaccgacccaatccgcatcttggtgaaacgtgatgaattgactctggaaggcatcaagcaatttttcgtggcagtggagagggaagagtggaaatttgacactctgtgtgacctctacgacacactgaccatcactcaggcggtcatcttctgcaacaccaaaagaaaggtggactggctgacggagaaaatgagggaagccaacttcactgtatcctcaatgcatggagacatgccccagaaagagcgggagtccatcatgaaggagttccggtcgggcgccagccgagtgcttatttctacagatgtctgggccagggggttggatgtccctcaggtgtccctcatcattaactatgatctccctaataacagagaattgtacatacacagaattgggagatcaggtcgatacggccggaagggtgtggccattaactttgtaaagaatgacgacatccgcatcctcagagatatcgagcagtactattccactcagattgatgagatgccgatgaacgttgctgatcttatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylinositol glycan anchor biosynthesis, class O
- general transcription factor IIF, polypeptide 1, 74kDa
- catenin (cadherin-associated protein), alpha 1, 102kDa
- guanine nucleotide binding protein (G protein) alpha 12

Buy EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene now

Add to cart