Login to display prices
Login to display prices
PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene View larger

PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene

PTXBC013987

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene

Proteogenix catalog: PTXBC013987
Ncbi symbol: PIGO
Product name: PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene
Size: 2ug
Accessions: BC013987
Gene id: 84720
Gene description: phosphatidylinositol glycan anchor biosynthesis, class O
Synonyms: HPMRS2; GPI ethanolamine phosphate transferase 3; phosphatidylinositol-glycan biosynthesis class O protein; phosphatidylinositol glycan anchor biosynthesis class O
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacagtggtgaatgggacgtgctgattgctcacttcctgggtgtggaccactgtggccacaagcatggccctcaccaccctgaaatggccaagaaacttagccagatggaccaggtgatccagggacttgtggagcgtctggagaatgacacactgctggtagtggctggggaccatgggatgaccacaaatggagaccatggaggggacagtgagctggaggtctcagctgctctctttctgtatagccccacagcagtcttccccagcaccccaccagaggagccagaggtgattcctcaagttagccttgtgcccacgctggccctgctgctgggcctgcccatcccatttgggaatatcggggaagtgatggctgagctattctcagggggtgaggactcccagccccactcctctgctttagcccaagcctcagctctccatctcaatgctcagcaggtgtcccgatttcttcatacctactcagctgctactcaggaccttcaagctaaggagcttcatcagctgcagaacctcttctccaaggcctctgctgactaccagtggcttctccagagccccaagggggctgaggcgacactgccgactgtgattgctgagctgcagcagttcctgcggggagctcgggccatgtgcatcgagtcttgggctcgtttctctctgagcttccttctcctacatctgcttgctgctgggatacccgtcaccacccctggtccttttactgtgccatggcaggcagtctcggcttgggccctcatggccacacagaccttctactccacaggccaccagcctgtctttccagccatccattggcatgcagccttcgtgggattcccagagggtcatggctcctgtacttggctgcctgctttgctagtgggagccaacacctttgcctcccacctcctctttgcagtaggttgcccactgctcctgctctggcctttcctgtgtgagagtcaagggctgcggaagagacagcagcccccagggaatgaagctgatgccagagtcagacccgaggaggaagaggagccactgatggagatgcggctccgggatgcgcctcagcacttctatgcagcactgctgcagctgggcctcaagtacctctttatccttggtattcagattctggcctgtgccttggcagcctccatccttcgcaggcatctcatggtctggaaagtgtttgcccctaagttcatatttgaggctgtgggcttcattgtgagcagcgtgggacttctcctgggcatagctttggtgatgagagtggatggtgctgtgagctcctggttcaggcagctatttctggcccagcagaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: