Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene
PTXBC000486
New product
Data sheet of SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000486 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNRPD2 |
| Origin species: | Human |
| Product name: | SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene |
| Size: | 2ug |
| Accessions: | BC000486 |
| Gene id: | 6633 |
| Gene description: | small nuclear ribonucleoprotein D2 polypeptide 16.5kDa |
| Synonyms: | SMD2; SNRPD1; Sm-D2; small nuclear ribonucleoprotein Sm D2; small nuclear ribonucleoprotein D2 polypeptide 16.5kDa; snRNP core protein D2; small nuclear ribonucleoprotein D2 polypeptide |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcctcctcaacaagcccaagagtgagatgaccccagaggagctgcagaagcgagaggaggaggaatttaacaccggtccactctctgtgctcacacagtcagtcaagaacaatacccaagtgctcatcaactgccgcaacaataagaaactcctgggccgcgtgaaggccttcgataggcactgcaacatggtgctggagaacgtgaaggagatgtggactgaggtacccaagagtggcaagggcaagaagaagtccaagccagtcaacaaagaccgctacatctccaagatgttcctgcgcggggactcagtcatcgtggtcctgcggaacccgctcatcgccggcaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol glycan anchor biosynthesis, class P - general transcription factor IIF, polypeptide 2, 30kDa - proteasome (prosome, macropain) subunit, beta type, 10 - transmembrane and tetratricopeptide repeat containing 4 |