SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene View larger

SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000486
Product type: DNA & cDNA
Ncbi symbol: SNRPD2
Origin species: Human
Product name: SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene
Size: 2ug
Accessions: BC000486
Gene id: 6633
Gene description: small nuclear ribonucleoprotein D2 polypeptide 16.5kDa
Synonyms: SMD2; SNRPD1; Sm-D2; small nuclear ribonucleoprotein Sm D2; small nuclear ribonucleoprotein D2 polypeptide 16.5kDa; snRNP core protein D2; small nuclear ribonucleoprotein D2 polypeptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcctcctcaacaagcccaagagtgagatgaccccagaggagctgcagaagcgagaggaggaggaatttaacaccggtccactctctgtgctcacacagtcagtcaagaacaatacccaagtgctcatcaactgccgcaacaataagaaactcctgggccgcgtgaaggccttcgataggcactgcaacatggtgctggagaacgtgaaggagatgtggactgaggtacccaagagtggcaagggcaagaagaagtccaagccagtcaacaaagaccgctacatctccaagatgttcctgcgcggggactcagtcatcgtggtcctgcggaacccgctcatcgccggcaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylinositol glycan anchor biosynthesis, class P
- general transcription factor IIF, polypeptide 2, 30kDa
- proteasome (prosome, macropain) subunit, beta type, 10
- transmembrane and tetratricopeptide repeat containing 4

Buy SNRPD2-small nuclear ribonucleoprotein D2 polypeptide 16.5kDa Gene now

Add to cart