GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene View larger

GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene

PTXBC001771

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001771
Product type: DNA & cDNA
Ncbi symbol: GTF2F2
Origin species: Human
Product name: GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene
Size: 2ug
Accessions: BC001771
Gene id: 2963
Gene description: general transcription factor IIF, polypeptide 2, 30kDa
Synonyms: ATP-dependent helicase GTF2F2; BTF4; RAP30; TF2F2; TFIIF; general transcription factor IIF subunit 2; TFIIF-beta; general transcription factor IIF 30 kDa subunit; general transcription factor IIF, polypeptide 2, 30kDa; transcription initiation factor IIF subunit beta; transcription initiation factor RAP30
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgagcgcggggaactcgacttgaccggcgccaaacagaacacaggagtgtggctagtcaaggttcctaaatatttgtcacagcaatgggctaaagcttctggaagaggtgaagttgggaaactgcggattgccaagactcaaggaaggactgaggtgtcatttactttgaatgaggatcttgcaaatattcatgatattggtggaaaaccagcttcagtcagtgctcctagagaacatccatttgtcttgcaaagtgttggaggacagacattaacagtatttactgagagctcatcagataagctgtcattggaaggaatagtggtacaaagagctgaatgccgaccagctgccagtgaaaactacatgcgattaaaaagattgcaaatagaagagtcttccaaaccagtgaggctatcacaacagctggacaaagttgtaacaaccaattacaaacctgttgctaatcatcaatacaatatcgaatatgaaaggaaaaagaaagaagacggaaagcgagctcgagctgataaacaacatgttttagacatgctattttcagcctttgagaaacatcaatactataatcttaaggacttggtggacatcacaaaacaacctgtggtgtacctgaaggaaatcttaaaagaaattggtgttcagaatgtaaaagggatccacaaaaacacatgggagctgaagccagagtacagacactatcaaggagaagaaaagagtgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, beta type, 10
- transmembrane and tetratricopeptide repeat containing 4
- eukaryotic translation initiation factor 4A, isoform 2
- G-protein signaling modulator 1 (AGS3-like, C. elegans)

Buy GTF2F2-general transcription factor IIF, polypeptide 2, 30kDa Gene now

Add to cart