Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene
PTXBC009979
New product
Data sheet of GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009979 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPSM1 |
| Origin species: | Human |
| Product name: | GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC009979 |
| Gene id: | 26086 |
| Gene description: | G-protein signaling modulator 1 (AGS3-like, C. elegans) |
| Synonyms: | G-protein-signaling modulator 1; G-protein signalling modulator 1 (AGS3-like, C. elegans); activator of G-protein signaling 3; G-protein signaling modulator 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcgtcctgcctagagctggcgctggagggcgagcgtctgtgcaaggcgggcgacttcaagacaggcgtggccttctttgaggctgctgtgcaggtgggcaccgaggacctgaagacactgagtgccatctacagccagctgggcaacgcctacttctacctgaaggagcacggccgggcgctggaataccacaagcatgacctcctgctggcgcggaccatcggtgaccgcatgggggaggccaaggccagtggaaacctgggaaacacactcaaggtcctggggcgcttcgacgaggctgccgtctgctgccagcggcatctgagcatcgcccaagagcagggagacaaggttggggaggcgagggccctctacaacatcgggaacgtgtaccacgccaaaggcaagcaactgtcctggaacgccgcaaacgccacgcaggaccccgggcacctgccgcccgatgtccgagagaccctgtgcaaggcctccgagttctacgagaggaacctgtccctggtgaaggagctgggcgaccgtgcggcgcagggcagggcctacggcaacctgggcaacacccactatttgttggggaacttcacagaggccacgaccttccacaaggagcgcctggccattgctaaggagtttggagacaaggcagccgagaggagggcctacagcaacctggggaacgcccacgtcttcctggggcgctttgacgtggccgccgagtactacaagaagacgctgcaactgtctcggcagctcagggaccaggcagtggaggcgcaggcctgctacagtctgggcaacacctacacgctgctgcaggactacgagcgcgcggccgagtaccacctgcggcacctgctcattgcccaggagctggccgacagagtgggcgagggccgggcgtgctggagcctgggaaatgcctacgtgtccatggggcgcccagcgcaggccctgaccttcgccaagaagcacctgcagatctcccaggagatcggggaccgccatggggagctcacggcccgcatgaacgtggcgcagctgcagctggtgctcggccgcctgaccagcccggcagcctcagagaagcctgacctggccggctatgaggcccagggtgagttccagggttgtgggggggtcttgctccccacaggcacggaccgcatcaggagctgcggaggggtgggatcgaggccaggccagcatggcggaggtggcagccgccagaaaatggcgcctacaagccagttcttcttggcctcagggacagcacaggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol glycan anchor biosynthesis, class Q - DIP2 disco-interacting protein 2 homolog A (Drosophila) - RAS p21 protein activator (GTPase activating protein) 1 - vesicle-associated membrane protein 2 (synaptobrevin 2) |