GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene View larger

GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene

PTXBC009979

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009979
Product type: DNA & cDNA
Ncbi symbol: GPSM1
Origin species: Human
Product name: GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene
Size: 2ug
Accessions: BC009979
Gene id: 26086
Gene description: G-protein signaling modulator 1 (AGS3-like, C. elegans)
Synonyms: G-protein-signaling modulator 1; G-protein signalling modulator 1 (AGS3-like, C. elegans); activator of G-protein signaling 3; G-protein signaling modulator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcgtcctgcctagagctggcgctggagggcgagcgtctgtgcaaggcgggcgacttcaagacaggcgtggccttctttgaggctgctgtgcaggtgggcaccgaggacctgaagacactgagtgccatctacagccagctgggcaacgcctacttctacctgaaggagcacggccgggcgctggaataccacaagcatgacctcctgctggcgcggaccatcggtgaccgcatgggggaggccaaggccagtggaaacctgggaaacacactcaaggtcctggggcgcttcgacgaggctgccgtctgctgccagcggcatctgagcatcgcccaagagcagggagacaaggttggggaggcgagggccctctacaacatcgggaacgtgtaccacgccaaaggcaagcaactgtcctggaacgccgcaaacgccacgcaggaccccgggcacctgccgcccgatgtccgagagaccctgtgcaaggcctccgagttctacgagaggaacctgtccctggtgaaggagctgggcgaccgtgcggcgcagggcagggcctacggcaacctgggcaacacccactatttgttggggaacttcacagaggccacgaccttccacaaggagcgcctggccattgctaaggagtttggagacaaggcagccgagaggagggcctacagcaacctggggaacgcccacgtcttcctggggcgctttgacgtggccgccgagtactacaagaagacgctgcaactgtctcggcagctcagggaccaggcagtggaggcgcaggcctgctacagtctgggcaacacctacacgctgctgcaggactacgagcgcgcggccgagtaccacctgcggcacctgctcattgcccaggagctggccgacagagtgggcgagggccgggcgtgctggagcctgggaaatgcctacgtgtccatggggcgcccagcgcaggccctgaccttcgccaagaagcacctgcagatctcccaggagatcggggaccgccatggggagctcacggcccgcatgaacgtggcgcagctgcagctggtgctcggccgcctgaccagcccggcagcctcagagaagcctgacctggccggctatgaggcccagggtgagttccagggttgtgggggggtcttgctccccacaggcacggaccgcatcaggagctgcggaggggtgggatcgaggccaggccagcatggcggaggtggcagccgccagaaaatggcgcctacaagccagttcttcttggcctcagggacagcacaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylinositol glycan anchor biosynthesis, class Q
- DIP2 disco-interacting protein 2 homolog A (Drosophila)
- RAS p21 protein activator (GTPase activating protein) 1
- vesicle-associated membrane protein 2 (synaptobrevin 2)

Buy GPSM1-G-protein signaling modulator 1 (AGS3-like, C. elegans) Gene now

Add to cart