Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene
PTXBC002737
New product
Data sheet of VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002737 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VAMP2 |
| Origin species: | Human |
| Product name: | VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene |
| Size: | 2ug |
| Accessions: | BC002737 |
| Gene id: | 6844 |
| Gene description: | vesicle-associated membrane protein 2 (synaptobrevin 2) |
| Synonyms: | SYB2; VAMP-2; vesicle-associated membrane protein 2; synaptobrevin 2; vesicle associated membrane protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgctaccgctgccacggccccccctgctgccccggctggggagggtggtccccctgcaccccctccaaacctcaccagtaacaggagactgcagcagacccaggcccaggtggatgaggtggtggacatcatgagggtgaacgtggacaaggtcctggagcgagaccagaagctgtcggagctggacgaccgtgcagatgcactccaggcgggggcctcccagtttgaaacaagcgcagccaagctcaagcgcaaatactggtggaaaaacctcaagatgatgatcatcttgggagtgatttgcgccatcatcctcatcatcatcatagtttacttcagcacttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vesicle-associated membrane protein 1 (synaptobrevin 1) - microtubule-associated protein 1 light chain 3 alpha - ATP-binding cassette, sub-family C (CFTR/MRP), member 9 - tumor necrosis factor (ligand) superfamily, member 14 |