VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene View larger

VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene

PTXBC002737

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002737
Product type: DNA & cDNA
Ncbi symbol: VAMP2
Origin species: Human
Product name: VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene
Size: 2ug
Accessions: BC002737
Gene id: 6844
Gene description: vesicle-associated membrane protein 2 (synaptobrevin 2)
Synonyms: SYB2; VAMP-2; vesicle-associated membrane protein 2; synaptobrevin 2; vesicle associated membrane protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgctaccgctgccacggccccccctgctgccccggctggggagggtggtccccctgcaccccctccaaacctcaccagtaacaggagactgcagcagacccaggcccaggtggatgaggtggtggacatcatgagggtgaacgtggacaaggtcctggagcgagaccagaagctgtcggagctggacgaccgtgcagatgcactccaggcgggggcctcccagtttgaaacaagcgcagccaagctcaagcgcaaatactggtggaaaaacctcaagatgatgatcatcttgggagtgatttgcgccatcatcctcatcatcatcatagtttacttcagcacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vesicle-associated membrane protein 1 (synaptobrevin 1)
- microtubule-associated protein 1 light chain 3 alpha
- ATP-binding cassette, sub-family C (CFTR/MRP), member 9
- tumor necrosis factor (ligand) superfamily, member 14

Buy VAMP2-vesicle-associated membrane protein 2 (synaptobrevin 2) Gene now

Add to cart