Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ABCC9-ATP-binding cassette, sub-family C (CFTR/MRP), member 9 Gene
PTXBC033804
New product
Data sheet of ABCC9-ATP-binding cassette, sub-family C (CFTR/MRP), member 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ABCC9-ATP-binding cassette, sub-family C (CFTR/MRP), member 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033804 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ABCC9 |
| Origin species: | Human |
| Product name: | ABCC9-ATP-binding cassette, sub-family C (CFTR/MRP), member 9 Gene |
| Size: | 2ug |
| Accessions: | BC033804 |
| Gene id: | 10060 |
| Gene description: | ATP-binding cassette, sub-family C (CFTR/MRP), member 9 |
| Synonyms: | ABC37; ATFB12; CANTU; CMD1O; SUR2; ATP-binding cassette sub-family C member 9; ATP-binding cassette transporter sub-family C member 9; ATP-binding cassette, sub-family C (CFTR/MRP), member 9; sulfonylurea receptor 2; ATP binding cassette subfamily C member 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcctttcattttgtggtaacaacatttcttcatataatatcaacgatggtgtactacaaaattcctgctttgtggatgccctcaacctggtccctcatgtctttctgttgtttatcacttttccaatattgtttattgggtgggggagccaaagctcaaaagtacaaattcaccacaacacatggcttcattttccgggacataacctgagatggattcttacattcgctctcctgtttgtgcatgtctgtgaaatagcagaaggcattgtttcagactcgcggcgggaatcaaggcacctccacctctttatgccagccgtgatgggattcgttgccactacaacatcgatagtgtattatcataatatcgaaacatcaaattttcctaaattacttttaggttttagccatcatgagagtaaaagctgctatcaacattcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor (ligand) superfamily, member 14 - MOB1, Mps One Binder kinase activator-like 1B (yeast) - phosphatidylinositol glycan anchor biosynthesis, class X - potassium channel tetramerisation domain containing 13 |