Login to display prices
Login to display prices
TNFSF14-tumor necrosis factor (ligand) superfamily, member 14 Gene View larger

TNFSF14-tumor necrosis factor (ligand) superfamily, member 14 Gene

PTXBC018058

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFSF14-tumor necrosis factor (ligand) superfamily, member 14 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNFSF14-tumor necrosis factor (ligand) superfamily, member 14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018058
Product type: DNA & cDNA
Ncbi symbol: TNFSF14
Origin species: Human
Product name: TNFSF14-tumor necrosis factor (ligand) superfamily, member 14 Gene
Size: 2ug
Accessions: BC018058
Gene id: 8740
Gene description: tumor necrosis factor (ligand) superfamily, member 14
Synonyms: CD258; HVEML; LTg; tumor necrosis factor ligand superfamily member 14; herpesvirus entry mediator ligand; tumor necrosis factor (ligand) superfamily, member 14; tumor necrosis factor ligand 1D; tumor necrosis factor superfamily member 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagagtgtcgtacggccctcagtgtttgtggtggatggacagaccgacatcccattcacgaggctgggacgaagccaccggagacagtcgtgcagtgtggcccgggtgggtctgggtctcttgctgttgctgatgggggccgggctggccgtccaaggctggttcctcctgcagctgcactggcgtctaggagagatggtcacccgcctgcctgacggacctgcaggctcctgggagcagctgatacaagagcgaaggtctcacgaggtcaacccagcagcgcatctcacaggggccaactccagcttgaccggcagcggggggccgctgttatgggagactcagctgggcgtggccttcctgaggggcctcagctaccacgatggggcccttgtggtcaccaaagctggctactactacatctactccaaggtgcagctgggcggtgtgggctgcccgctgggcctggccagcaccatcacccacggcctctacaagcgcacaccccgctaccccgaggagctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MOB1, Mps One Binder kinase activator-like 1B (yeast)
- phosphatidylinositol glycan anchor biosynthesis, class X
- potassium channel tetramerisation domain containing 13
- phosphatidylinositol glycan anchor biosynthesis, class K