Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFSF14-tumor necrosis factor (ligand) superfamily, member 14 Gene
PTXBC018058
New product
Data sheet of TNFSF14-tumor necrosis factor (ligand) superfamily, member 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFSF14-tumor necrosis factor (ligand) superfamily, member 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018058 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFSF14 |
| Origin species: | Human |
| Product name: | TNFSF14-tumor necrosis factor (ligand) superfamily, member 14 Gene |
| Size: | 2ug |
| Accessions: | BC018058 |
| Gene id: | 8740 |
| Gene description: | tumor necrosis factor (ligand) superfamily, member 14 |
| Synonyms: | CD258; HVEML; LTg; tumor necrosis factor ligand superfamily member 14; herpesvirus entry mediator ligand; tumor necrosis factor (ligand) superfamily, member 14; tumor necrosis factor ligand 1D; tumor necrosis factor superfamily member 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagagtgtcgtacggccctcagtgtttgtggtggatggacagaccgacatcccattcacgaggctgggacgaagccaccggagacagtcgtgcagtgtggcccgggtgggtctgggtctcttgctgttgctgatgggggccgggctggccgtccaaggctggttcctcctgcagctgcactggcgtctaggagagatggtcacccgcctgcctgacggacctgcaggctcctgggagcagctgatacaagagcgaaggtctcacgaggtcaacccagcagcgcatctcacaggggccaactccagcttgaccggcagcggggggccgctgttatgggagactcagctgggcgtggccttcctgaggggcctcagctaccacgatggggcccttgtggtcaccaaagctggctactactacatctactccaaggtgcagctgggcggtgtgggctgcccgctgggcctggccagcaccatcacccacggcctctacaagcgcacaccccgctaccccgaggagctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MOB1, Mps One Binder kinase activator-like 1B (yeast) - phosphatidylinositol glycan anchor biosynthesis, class X - potassium channel tetramerisation domain containing 13 - phosphatidylinositol glycan anchor biosynthesis, class K |