PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene View larger

PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026186
Product type: DNA & cDNA
Ncbi symbol: PIGK
Origin species: Human
Product name: PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene
Size: 2ug
Accessions: BC026186
Gene id: 10026
Gene description: phosphatidylinositol glycan anchor biosynthesis, class K
Synonyms: GPI8; GPI-anchor transamidase; GPI transamidase subunit; GPI8 homolog; PIG-K; phosphatidylinositol glycan, class K; phosphatidylinositol-glycan biosynthesis class K protein; phosphatidylinositol glycan anchor biosynthesis class K
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgtcaccgacagcctcagccgggctgcgactgtcttggcaactgtgttgctcttgtccttcggcagcgtggccgctagtcatatcgaggatcaagcagaacaattctttagaagtggccatacaaacaactgggctgttctggtgtgtacatcccgattctggtttaattatcgacatgttgcaaataccctttctgtttatagaagtgtcaagaggctaggtattcctgacagtcacattgtcctaatgcttgcagatgatatggcctgtaatcctagaaatcccaaaccagctacagtgtttagtcacaagaatatggaactaaatgtgtatggagatgatgtggaagtggattatagaagttatgaggtaactgtggagaattttttacgggtattaactggggggatcccacctagtactcctcggtcaaaacgtcttctttctgatgacagaagcaatattctaatttatatgacagggcatggtggaaatggtttcttaaaatttcaagattctgaagaaattaccaacatagaactcgcggatgcttttgaacaaatgtggcagaaaagacgctacaatgagctactgtttattattgatacttgccaaggagcatccatgtatgaacgattttattctcctaacataatggctctagctagtagtcaagtgggagaagattcactctcgcatcaacctgatcctgcaattggagtccatcttatggatagatacacattttatgtcttggaatttttggaagaaattaacccagctagccaaactaatatgaatgacctttttcaggtatgtcccaaaagtctgtgtgtgtctactcctggacatcgcactgatctttttcagagggatcctaaaaatgtactgataactgatttctttggaagtgtacggaaagtggaaattacaacagagactattaaattgcaacaggattcagaaatcatggaaagcaggtattcatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle 37 homolog (S. cerevisiae)-like 1
- eukaryotic translation initiation factor 4A, isoform 2
- eukaryotic translation initiation factor 4A, isoform 2
- solute carrier family 30 (zinc transporter), member 4

Buy PIGK-phosphatidylinositol glycan anchor biosynthesis, class K Gene now

Add to cart