CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene View larger

CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene

PTXBC014133

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014133
Product type: DNA & cDNA
Ncbi symbol: CDC37L1
Origin species: Human
Product name: CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene
Size: 2ug
Accessions: BC014133
Gene id: 55664
Gene description: cell division cycle 37 homolog (S. cerevisiae)-like 1
Synonyms: CDC37B; HARC; hsp90 co-chaperone Cdc37-like 1; CDC37 cell division cycle 37 homolog-like 1; Hsp90-associating relative of Cdc37; cell division cycle 37 homolog-like 1; cell division cycle 37 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacaaccgtggccgcctccgggaccctggagcctccctcgggccgagggtgaggctgaggaagagagtgacttcgacgtgttccccagttctccccgctgcccgcagctgccaggcggcggcgcccagatgtatagccatggaattgaattggcttgccaaaagcagaaagagtttgtgaagagctctgtggcgtgcaaatggaatcttgctgaagctcaacagaaacttggtagcttagcactgcataattctgagtccttggatcaggagcatgccaaagcacaaacagcagtatcagaactgaggcaacgggaagaagagtggcgacagaaagaagaagctctagtacaaagagagaagatgtgtctgtggagcacggatgccattagcaaggatgtttttaataagagttttattaatcaagataaaagaaaagacacagaagatgaagataaatcagaatcatttatgcaaaaatatgagcaaaaaatcagacattttggtatgttgagtcgatgggatgatagccagagatttttgtctgaccatccataccttgtatgtgaagaaactgctaaatatcttattttatggtgttttcacctggaagctgagaagaaaggggctttaatggaacaaatagcacatcaagctgttgtaatgcagtttattatggaaatggccaaaaactgtaatgtggatccaagagggtgttttcgtttatttttccagaaagccaaagcagaggaagaaggttattttgaagcattcaaaaatgaacttgaagctttcaagtcaagagtaagactttattctcaatcacaaagttttcaacctatgacagttcagaatcatgttccccattctggtgttggatctataggtttattagaatccttaccacagaatccagattatcttcagtattctatcagtacagctctctgcagcttaaactcggtggtacataaagaagatgatgaacccaaaatgatggacactgtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 4A, isoform 2
- eukaryotic translation initiation factor 4A, isoform 2
- solute carrier family 30 (zinc transporter), member 4
- phosphatidylinositol glycan anchor biosynthesis, class O

Buy CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene now

Add to cart