Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene
PTXBC014133
New product
Data sheet of CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014133 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDC37L1 |
| Origin species: | Human |
| Product name: | CDC37L1-cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC014133 |
| Gene id: | 55664 |
| Gene description: | cell division cycle 37 homolog (S. cerevisiae)-like 1 |
| Synonyms: | CDC37B; HARC; hsp90 co-chaperone Cdc37-like 1; CDC37 cell division cycle 37 homolog-like 1; Hsp90-associating relative of Cdc37; cell division cycle 37 homolog-like 1; cell division cycle 37 like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacaaccgtggccgcctccgggaccctggagcctccctcgggccgagggtgaggctgaggaagagagtgacttcgacgtgttccccagttctccccgctgcccgcagctgccaggcggcggcgcccagatgtatagccatggaattgaattggcttgccaaaagcagaaagagtttgtgaagagctctgtggcgtgcaaatggaatcttgctgaagctcaacagaaacttggtagcttagcactgcataattctgagtccttggatcaggagcatgccaaagcacaaacagcagtatcagaactgaggcaacgggaagaagagtggcgacagaaagaagaagctctagtacaaagagagaagatgtgtctgtggagcacggatgccattagcaaggatgtttttaataagagttttattaatcaagataaaagaaaagacacagaagatgaagataaatcagaatcatttatgcaaaaatatgagcaaaaaatcagacattttggtatgttgagtcgatgggatgatagccagagatttttgtctgaccatccataccttgtatgtgaagaaactgctaaatatcttattttatggtgttttcacctggaagctgagaagaaaggggctttaatggaacaaatagcacatcaagctgttgtaatgcagtttattatggaaatggccaaaaactgtaatgtggatccaagagggtgttttcgtttatttttccagaaagccaaagcagaggaagaaggttattttgaagcattcaaaaatgaacttgaagctttcaagtcaagagtaagactttattctcaatcacaaagttttcaacctatgacagttcagaatcatgttccccattctggtgttggatctataggtttattagaatccttaccacagaatccagattatcttcagtattctatcagtacagctctctgcagcttaaactcggtggtacataaagaagatgatgaacccaaaatgatggacactgtataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 4A, isoform 2 - eukaryotic translation initiation factor 4A, isoform 2 - solute carrier family 30 (zinc transporter), member 4 - phosphatidylinositol glycan anchor biosynthesis, class O |