PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene View larger

PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001030
Product type: DNA & cDNA
Ncbi symbol: PIGO
Origin species: Human
Product name: PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene
Size: 2ug
Accessions: BC001030
Gene id: 84720
Gene description: phosphatidylinositol glycan anchor biosynthesis, class O
Synonyms: HPMRS2; GPI ethanolamine phosphate transferase 3; phosphatidylinositol-glycan biosynthesis class O protein; phosphatidylinositol glycan anchor biosynthesis class O
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacagtggtgaatgggaagtgagcaatcagcacgtcctgggtgtggaccactgtggtcacaagcatggccctcaccaccctgaaatggccaagaaacttagccagatggaccaggtgatccagggacttgtggagcgtctggagaatgacacactgctggtagtggctggggaccatgggatgaccacaaatggagaccatggaggggacagtgagctggaggtctcagctgctctctttctgtatagccccacagcagtcttccccagcaccccaccagaggagccagaggtgattcctcaagttagccttgtgcccacgctggccctgctgctgggcctgcccatcccatttgggaatatcggggaagtgatggctgagctattctcagggggtgaggactcccagccccactcctctgctttagcccaagcctcagctctccatctcaatgctcagcaggtgtcccgatttcttcatacctactcagctgctactcaggaccttcaagctaaggagcttcatcagctgcagaacctcttctccaaggcctctgctgactaccagtggcttctccagagccccaagggggctgaggcgacactgccgactgtgattgctgagctgcagcagttcctgcggggagctcgggccatgtgcatcgagtcttgggctcgtttctctctgagcttccttctcctacatctgcttgctgctgggatacccgtcaccacccctggtccttttactgtgccatggcaggcagtctcggcttgggccctcatggccacacagaccttctactccacaggccaccagcctgtctttccagccatccattggcatgcagccttcgtgggattcccagagggtcatggctcctgtacttggctgcctgctttgctagtgggagccaacacctttgcctcccacctcctctttgcagtaggttgcccactgctcctgctctggcctttcctgtgtgagagtcaagggctgcggaagagacagcagcccccagggaatgaagctgatgccagagtcagacccgaggaggaagaggagccactgatggagatgcggctccgggatgcgcctcagcacttctatgcagcactgctgcagctgggcctcaagtacctctttatccttggtattcagattctggcctgtgccttggcagcctccatccttcgcaggcatctcatggtctggaaagtgtttgcccctaagttcatatttgaggctgtgggcttcattgtgagcagcgtgggacttctcctgggcatagctttggtgatgagagtggatggtgctgtgagctcctggttcaggcagctatttctggcccagcagaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 39 (zinc transporter), member 7
- glutathione S-transferase, C-terminal domain containing
- solute carrier family 48 (heme transporter), member 1
- solute carrier family 48 (heme transporter), member 1

Buy PIGO-phosphatidylinositol glycan anchor biosynthesis, class O Gene now

Add to cart