Login to display prices
Login to display prices
SLC48A1-solute carrier family 48 (heme transporter), member 1 Gene View larger

SLC48A1-solute carrier family 48 (heme transporter), member 1 Gene

PTXBC002759

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC48A1-solute carrier family 48 (heme transporter), member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC48A1-solute carrier family 48 (heme transporter), member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002759
Product type: DNA & cDNA
Ncbi symbol: SLC48A1
Origin species: Human
Product name: SLC48A1-solute carrier family 48 (heme transporter), member 1 Gene
Size: 2ug
Accessions: BC002759
Gene id: 55652
Gene description: solute carrier family 48 (heme transporter), member 1
Synonyms: HRG-1; HRG1; hHRG-1; heme transporter HRG1; heme-responsive gene 1 protein homolog; solute carrier family 48 (heme transporter), member 1; solute carrier family 48 member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacatgcaagattattggaggacctggctcaaggggctgcgcggcttcttcttcgtgggcgtcctcttctcggccgtctccatcgctgccttctgcaccttcctcgtgctggccatcacccggcatcagagcctcacagaccccaccagctactacctctccagcgtctggagcttcatttccttcaagtgggccttcctgctcagcctctatgcccaccgctaccgggctgactttgctgacatcagcatcctcagcgatttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 48 (heme transporter), member 1
- spermidine/spermine N1-acetyltransferase family member 2
- eukaryotic translation initiation factor 4A, isoform 2
- TRAF-interacting protein with forkhead-associated domain