Login to display prices
Login to display prices
TIFA-TRAF-interacting protein with forkhead-associated domain Gene View larger

TIFA-TRAF-interacting protein with forkhead-associated domain Gene

PTXBC014259

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIFA-TRAF-interacting protein with forkhead-associated domain Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TIFA-TRAF-interacting protein with forkhead-associated domain Gene

Proteogenix catalog: PTXBC014259
Ncbi symbol: TIFA
Product name: TIFA-TRAF-interacting protein with forkhead-associated domain Gene
Size: 2ug
Accessions: BC014259
Gene id: 92610
Gene description: TRAF-interacting protein with forkhead-associated domain
Synonyms: T2BP; T6BP; TIFAA; TRAF-interacting protein with FHA domain-containing protein A; TRAF-interacting protein with a forkhead-associated domain; TRAF2 binding protein; TRAF6 binding protein; TRAF interacting protein with forkhead associated domain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccagttttgaagatgctgacacagaagagacagtaacttgtctccagatgacggtttaccatcctggccagttgcagtgtggaatatttcagtcaataagttttaacagagagaaactcccttccagcgaagtggtgaaatttggccgaaattccaacatctgtcattatacttttcaggacaaacaggtttcccgagttcagttttctctgcagctgtttaaaaaattcaacagctcagttctctcctttgaaataaaaaatatgagtaaaaagaccaatctgatcgtggacagcagagagctgggctacctaaataaaatggacctgccatacaggtgcatggtcagattcggagagtatcagtttctgatggagaaggaagatggcgagtcattggaattttttgagactcaatttattttatctccaagatcactcttgcaagaaaacaactggccaccacacaggcccataccggagtatggcacttactcgctctgctcctcccaaagcagttctccgacagaaatggatgaaaatgagtcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice