No products
Prices are tax excluded
PTXBC014259
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014259 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIFA |
| Origin species: | Human |
| Product name: | TIFA-TRAF-interacting protein with forkhead-associated domain Gene |
| Size: | 2ug |
| Accessions: | BC014259 |
| Gene id: | 92610 |
| Gene description: | TRAF-interacting protein with forkhead-associated domain |
| Synonyms: | T2BP; T6BP; TIFAA; TRAF-interacting protein with FHA domain-containing protein A; TRAF-interacting protein with a forkhead-associated domain; TRAF2 binding protein; TRAF6 binding protein; TRAF interacting protein with forkhead associated domain |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccagttttgaagatgctgacacagaagagacagtaacttgtctccagatgacggtttaccatcctggccagttgcagtgtggaatatttcagtcaataagttttaacagagagaaactcccttccagcgaagtggtgaaatttggccgaaattccaacatctgtcattatacttttcaggacaaacaggtttcccgagttcagttttctctgcagctgtttaaaaaattcaacagctcagttctctcctttgaaataaaaaatatgagtaaaaagaccaatctgatcgtggacagcagagagctgggctacctaaataaaatggacctgccatacaggtgcatggtcagattcggagagtatcagtttctgatggagaaggaagatggcgagtcattggaattttttgagactcaatttattttatctccaagatcactcttgcaagaaaacaactggccaccacacaggcccataccggagtatggcacttactcgctctgctcctcccaaagcagttctccgacagaaatggatgaaaatgagtcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - MOB1, Mps One Binder kinase activator-like 2B (yeast) - solute carrier family 30 (zinc transporter), member 6 - potassium channel tetramerisation domain containing 14 - tumor necrosis factor (ligand) superfamily, member 13 |