KCTD14-potassium channel tetramerisation domain containing 14 Gene View larger

KCTD14-potassium channel tetramerisation domain containing 14 Gene

PTXBC001062

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCTD14-potassium channel tetramerisation domain containing 14 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCTD14-potassium channel tetramerisation domain containing 14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001062
Product type: DNA & cDNA
Ncbi symbol: KCTD14
Origin species: Human
Product name: KCTD14-potassium channel tetramerisation domain containing 14 Gene
Size: 2ug
Accessions: BC001062
Gene id: 65987
Gene description: potassium channel tetramerisation domain containing 14
Synonyms: BTB/POZ domain-containing protein KCTD14; potassium channel tetramerisation domain containing 14; potassium channel tetramerization domain containing 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctactgttgtggagctgaacgtcgggggtgagttccacaccaccaccctgggtaccctgaggaagtttccgggctcaaagctggcagagatgttctctagcttagccaaggcctccacggacgcggagggccgcttcttcatcgaccgccccagcacctatttcagacccatcctggactacctgcgcactgggcaagtgcccacacagcacatccctgaagtgtaccgtgaggctcagttctacgaaatcaagcctttggtcaagctgctggaggacatgccacagatctttggtgagcaggtgtctcggaagcagtttttgctgcaagtgccgggctacagcgagaacctggagctcatggtgcgcctggcacgtgcagaagccataacagcacggaagtccagcgtgcttgtgtgcctggtggaaactgaggagcaggatgcatattattcagaggtcctgtgttttctgcaggataagaagatgttcaagtctgttgtcaagtttgggccctggaaggcggtcctagacaacagcgacctcatgcactgcctggagatggacattaaggcccaggggtacaaggtattctccaagttctacctgacgtaccccaccaaaagaaacgaattccattttaacatttattcattcaccttcacctggtggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor (ligand) superfamily, member 13
- potassium channel tetramerisation domain containing 17
- microtubule-associated protein, RP/EB family, member 3
- solute carrier family 30 (zinc transporter), member 2

Buy KCTD14-potassium channel tetramerisation domain containing 14 Gene now

Add to cart