Login to display prices
Login to display prices
MAPRE3-microtubule-associated protein, RP/EB family, member 3 Gene View larger

MAPRE3-microtubule-associated protein, RP/EB family, member 3 Gene

PTXBC011557

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPRE3-microtubule-associated protein, RP/EB family, member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAPRE3-microtubule-associated protein, RP/EB family, member 3 Gene

Proteogenix catalog: PTXBC011557
Ncbi symbol: MAPRE3
Product name: MAPRE3-microtubule-associated protein, RP/EB family, member 3 Gene
Size: 2ug
Accessions: BC011557
Gene id: 22924
Gene description: microtubule-associated protein, RP/EB family, member 3
Synonyms: EB3; EBF3; EBF3-S; RP3; microtubule-associated protein RP/EB family member 3; APC binding protein; EB1 protein family member 3; end-binding protein 3; microtubule associated protein RP/EB family member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgtcaatgtgtactccacatctgtgaccagtgaaaatctgagtcgccatgatatgcttgcatgggtcaacgactccctgcacctcaactataccaagatagaacagctttgttcaggggcagcctactgccagttcatggacatgctcttccccggctgtgtgcacttgaggaaagtgaagttccaggccaaactagagcatgaatacatccacaacttcaaggtgctgcaagcagctttcaagaagatgggtgttgacaaaatcattcctgtagagaaattagtgaaaggaaaattccaagataattttgagtttattcagtggtttaagaaattctttgacgcaaactatgatggaaaggattacaaccctctgctggcgcggcagggccaggacgtagcgccacctcctaacccaggtgatcagatcttcaacaaatccaagaaactcattggcacagcagttccacagaggacgtcccccacaggcccaaaaaacatgcagacctctggccggctgagcaatgtggcccccccctgcattctccggaagaatcctccatcagcccgaaatggcggccatgagactgatgcccaaattcttgaactcaaccaacagctggtggacttgaagctgacagtggatgggctggagaaggaacgtgacttctacttcagcaaacttcgtgacatcgagctcatctgccaggagcatgaaagtgaaaacagccctgttatctcaggcatcattggcatcctctatgccacagaggaaggattcgcaccccctgaggacgatgagattgaagagcatcaacaagaagaccaggacgagtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: