Login to display prices
Login to display prices
PPP1CB-protein phosphatase 1, catalytic subunit, beta isoform Gene View larger

PPP1CB-protein phosphatase 1, catalytic subunit, beta isoform Gene

PTXBC002697

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP1CB-protein phosphatase 1, catalytic subunit, beta isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1CB-protein phosphatase 1, catalytic subunit, beta isoform Gene

Proteogenix catalog: PTXBC002697
Ncbi symbol: PPP1CB
Product name: PPP1CB-protein phosphatase 1, catalytic subunit, beta isoform Gene
Size: 2ug
Accessions: BC002697
Gene id: 5500
Gene description: protein phosphatase 1, catalytic subunit, beta isoform
Synonyms: HEL-S-80p; PP-1B; PP1B; PP1beta; PPP1CD; serine/threonine-protein phosphatase PP1-beta catalytic subunit; epididymis secretory sperm binding protein Li 80p; protein phosphatase 1, catalytic subunit, beta isoform; protein phosphatase 1, catalytic subunit, beta isozyme; protein phosphatase 1, catalytic subunit, delta isoform; protein phosphatase 1-beta; protein phosphatase 1-delta; protein phosphatase 1 catalytic subunit beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacggggagctgaacgtggacagcctcatcacccggctgctggaggtacgaggatgtcgtccaggaaagattgtgcagatgactgaagcagaagttcgaggcttatgtatcaagtctcgggagatctttctcagccagcctattcttttggaattggaagcaccgctgaaaatttgtggagatattcatggacagtatacagatttactgagattatttgaatatggaggtttcccaccagaagccaactatcttttcttaggagattatgtggacagaggaaagcagtctttggaaaccatttgtttgctattggcttataaaatcaaatatccagagaacttctttctcttaagaggaaaccatgagtgtgctagcatcaatcgcatttatggattctatgatgaatgcaaacgaagatttaatattaaattgtggaagaccttcactgattgttttaactgtctgcctatagcagccattgtggatgagaagatcttctgttgtcatggaggattgtcaccagacctgcaatctatggagcagattcggagaattatgagacctactgatgtccctgatacaggtttgctctgtgatttgctatggtctgatccagataaggatgtgcaaggctggggagaaaatgatcgtggtgtttcctttacttttggagctgatgtagtcagtaaatttctgaatcgtcatgatttagatttgatttgtcgagctcatcaggtggtggaagatggatatgaattttttgctaaacgacagttggtaaccttattttcagccccaaattactgtggcgagtttgataatgctggtggaatgatgagtgtggatgaaactttgatgtgttcatttcagatattgaaaccatctgaaaagaaagctaaataccagtatggtggactgaattctggacgtcctgtcactccacctcgaacagctaatccgccgaagaaaaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: