Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CHST1-carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 Gene
PTXBC022567
New product
Data sheet of CHST1-carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHST1-carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022567 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHST1 |
| Origin species: | Human |
| Product name: | CHST1-carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 Gene |
| Size: | 2ug |
| Accessions: | BC022567 |
| Gene id: | 8534 |
| Gene description: | carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 |
| Synonyms: | C6ST; GST-1; KS6ST; KSGal6ST; KSST; carbohydrate sulfotransferase 1; Keratan sulfotransferase; carbohydrate (chondroitin 6/keratan) sulfotransferase 1; carbohydrate (keratan sulfate Gal-6) sulfotransferase 1; galactose/N-acetylglucosamine/N-acetylglucosamine 6-O-sulfotransferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaatgttcctggaaggccgtcctcctccttgccctggcctccattgccatccagtacacggccatccgcaccttcaccgccaagtcctttcacacctgccccgggctggcagaggccgggctggccgagcgactgtgcgaggagagccccaccttcgcctacaacctctcccgcaagacccacatcctcatcctggccaccacgcgcagcggctcctccttcgtgggccagctcttcaaccagcacctggacgtcttctacctgtttgagcccctctaccacgtccagaacacgctcatcccccgcttcacccagggcaagagcccggccgaccggcgggtcatgctaggcgccagccgcgacctcctgcggagcctctacgactgcgacctctacttcctggagaactacatcaagccgccgccggtcaaccacaccaccgacaggatcttccgccgcggggccagccgggtcctctgctcccggcctgtgtgcgaccctccggggccagccgacctggtcctggaggagggggactgtgtgcgcaagtgcgggctactcaacctgaccgtggcggccgaggcgtgccgcgagcgcagccacgtggccatcaagacggtgcgcgtgcccgaggtgaacgacctgcgcgccctggtggaagacccgcgattaaacctcaaggtcatccagctggtccgagacccccgcggcattctggcttcgcgcagcgagaccttccgcgacacgtaccggctctggcggctctggtacggcaccgggaggaaaccctacaacctggacgtgacgcagctgaccacggtgtgcgaggacttctccaactccgtgtccaccggcctcatgcggcccccgtggctcaagggcaagtacatgttggtgcgctacgaggacctggctcggaaccctatgaagaagaccgaggagatctacgggttcctgggcatcccgctggacagccacgtggcccgctggatccagaacaacacgcggggcgaccccaccctgggcaagcacaaatacggcaccgtgcgaaactcggcggccacggccgagaagtggcgcttccgcctctcctacgacatcgtggcctttgcccagaacgcctgccagcaggtgctggcccagctgggctacaagatcgccgcctcggaggaggagctgaagaacccctcggtcagcctggtggaggagcgggacttccgccccttctcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol glycan anchor biosynthesis, class M - solute carrier family 39 (zinc transporter), member 8 - zinc metallopeptidase (STE24 homolog, S. cerevisiae) - asparaginyl-tRNA synthetase 2, mitochondrial (putative) |