Login to display prices
Login to display prices
NARS2-asparaginyl-tRNA synthetase 2, mitochondrial (putative) Gene View larger

NARS2-asparaginyl-tRNA synthetase 2, mitochondrial (putative) Gene

PTXBC007800

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NARS2-asparaginyl-tRNA synthetase 2, mitochondrial (putative) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NARS2-asparaginyl-tRNA synthetase 2, mitochondrial (putative) Gene

Proteogenix catalog: PTXBC007800
Ncbi symbol: NARS2
Product name: NARS2-asparaginyl-tRNA synthetase 2, mitochondrial (putative) Gene
Size: 2ug
Accessions: BC007800
Gene id: 79731
Gene description: asparaginyl-tRNA synthetase 2, mitochondrial (putative)
Synonyms: DFNB94; SLM5; asnRS; asparagine tRNA ligase 2, mitochondrial (putative); deafness, autosomal recessive 94; asparaginyl-tRNA synthetase 2, mitochondrial (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggggtccgctgcctgctgcggtccgtgcgcttctgttcctccgcccccttccccaagcacaaaccttcagccaaactgagcgtgcgggacgctctcggggctcagaacgcgagtggggagcgcattaagatccagggatggattcgttctgtccgatcccagaaggaagtcttgttcctgcatgtaaatgatgggtcatctttggaaagccttcaggttgttgcagattcaggccttgacagtagagaattaacttttgggagttctgtggaagtacaagggcagctgataaaaagtccatccaaaaggcaaaatgtggaactgaaggcagaaaaaattaaagttattggaaattgtgatgccaaggatttccccatcaaatataaagagaggcatcctctggagtacctgcgacaatatcctcactttaggtgtaggactaacgttctgggttctatattgaggattcgcagtgaagcgacagctgctattcattctttctttaaggacagtggctttgtacatattcatactccaataatcacatccaatgactctgagggagctggagaactttttcaacttgaaccttcaggcaaacttaaggtacctgaggagaatttcttcaatgttcctgctttcttaactgtctcaggacaacttcatctagaagtgatgtcaggagcttttactcaagtgtttacctttggtccgaccttccgagctgaaaattctcagagccggaggcacctggcagagttttatatgatagaagcagagatttcttttgttgacagccttcaagatcttatgcaggttatagaggaactgttcaaggctacaacaatgatggttctctcaaaatgtcctgaagatgttgaactctgtcacaaattcatagcacctggccaaaaggacagattagaacatatgctaaaaaacaactttttaatcatttcttatactgaagcagtggagatcttaaagcaagcatcccagaacttcacctttaccccagagtggggtgctgacctacggactgaacatgaaaagtacctggtgaagcactgtggcaacatacctgtcttcgttattaattatccattaacactcaagcctttctacatgagggataatgaagatggccctcagcacacggttgctgctgttgatcttctggttcctggagttggggaactctttggaggaggcctcagagaagaacgataccatttcttagaggagcgcttagccagatcgggacttacagaagtctaccaatggtatctggaccttcgtcgatttggatctgtgccacatggaggttttgggatgggatttgaacgctacctgcagtgcatcttgggtgttgacaatatcaaagatgttatccctttcccaaggtttcctcattcatgccttttatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: