PIGA-phosphatidylinositol glycan anchor biosynthesis, class A Gene View larger

PIGA-phosphatidylinositol glycan anchor biosynthesis, class A Gene

PTXBC038236

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIGA-phosphatidylinositol glycan anchor biosynthesis, class A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIGA-phosphatidylinositol glycan anchor biosynthesis, class A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038236
Product type: DNA & cDNA
Ncbi symbol: PIGA
Origin species: Human
Product name: PIGA-phosphatidylinositol glycan anchor biosynthesis, class A Gene
Size: 2ug
Accessions: BC038236
Gene id: 5277
Gene description: phosphatidylinositol glycan anchor biosynthesis, class A
Synonyms: GPI3; MCAHS2; PIG-A; PNH1; phosphatidylinositol N-acetylglucosaminyltransferase subunit A; GLCNAC-PI synthesis protein; GPI anchor biosynthesis; class A GlcNAc-inositol phospholipid assembly protein; phosphatidylinositol-glycan biosynthesis, class A protein; phosphatidylinositol glycan anchor biosynthesis class A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctgtagaggaggagctgggaatggccaccgtgcctcagctacactctctcgggttagccctggaagtctttacacatgtagaacccgtacccataatatatgcatggtatctgactttttctacccaaatatgggaggcgtggaaagccacatttaccagctctctcagtgcctgattgaaagagggcataaggttataattgtcacccatgcttatggaaatcgaaaaggcatccgttacctcaccagtggcctcaaagtctattacttgcctctgaaagtcatgtacaaccagtctacagccacgaccctctttcacagtctgccattgctcaggtacatatttgttcgggagagagtcacgataatccattcacatagttctttttctgctatggcccatgatgctctcttccacgccaagacaatggggcttcagacagtcttcacggaccattccctttttggatttgctgatgtcagctcggtgcttacaaacaagcttctaaccgtgtctctttgtgatacaaaccacatcatttgtgtgtcttatactagtaaggaaaatactgtactaagagcagcactgaatcctgaaatagtgtccgtcattcctaatgctgtagatcctactgacttcactccagacccatttagaaggcatgatagtataactattgttgttgtcagcagacttgtttacagaaaagggatcgatttgcttagtggtataatacctgaactctgtcagaaatatccagatttaaatttcataattggaggagagggaccaaagagaatcattttggaagaagttcgggaaagataccagctgcatgacagggtgcgtcttttgggagctttagaacacaaggatgttagaaatgtcttagttcaaggacatatttttctgaatacctcccttactgaagcattctgcatggcgatcgtggaagcagccagttgtggtttacaggttgtaagtaccagagttggtggaattcctgaggtgcttccagaaaaccttattattttatgtgagccttcagtaaaatctttgtgtgaaggattggaaaaggctattttccaactgaagtcagggacattgccagctccagaaaacatccataacatagtaaagactttctacacctggaggaatgttgcagaaagaactgaaaaggtatatgaccgggtatcagtggaagctgtgttgccaatggacaaacgactggacagacttatttctcactgcggcccagtaacaggctacatctttgctttgttggcagttttcaacttcctcttcctcattttcttgagatggatgactccagattctatcattgatgttgcaatagatgccactgggccacggggtgcctggactaataactattctcacagtaaaagagggggtgagaataatgagatatctgaaaccaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitogen-activated protein kinase associated protein 1
- phosphatidylinositol glycan anchor biosynthesis, class V
- glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
- UDP glucuronosyltransferase 1 family, polypeptide A10

Buy PIGA-phosphatidylinositol glycan anchor biosynthesis, class A Gene now

Add to cart