MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene View larger

MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene

PTXBC002326

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002326
Product type: DNA & cDNA
Ncbi symbol: MAPKAP1
Origin species: Human
Product name: MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene
Size: 2ug
Accessions: BC002326
Gene id: 79109
Gene description: mitogen-activated protein kinase associated protein 1
Synonyms: TORC2 subunit MAPKAP1; target of rapamycin complex 2 subunit MAPKAP1; JC310; MIP1; SIN1; SIN1b; SIN1g; MEKK2-interacting protein 1; SAPK-interacting protein 1; mSIN1; mitogen-activated protein kinase 2-associated protein 1; ras inhibitor MGC2745; stress-activated map kinase interacting protein 1; stress-activated protein kinase-interacting 1; mitogen-activated protein kinase associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccttcttggacaatccaactatcattctagctcatattcgacagtcacatgtgaccagtgatgacacgggaatgtgtgagatggttctcattgatcatgatgttgacctagagaagattcatcctccttcaatgcctggagacagtgggtcagaaattcagggaagcaatggtgagactcagggctatgtatatgcccagtcagtcgatattacctcaagttgggactttggtattagaagacgctcaaacacagctcaaagattagaacgactccgaaaagagagacaaaaccagatcaaatgcaaaaatattcagtggaaagaaagaaattctaagcaatcagcccaggagttaaagtcactgtttgaaaaaaaatctctcaaagagaagcctccaatttctgggaagcagtcgatattatctgtacgcctagaacagtgccctctgcagctgaataacccttttaacgagtattccaaatttgatggcaagggtcatgtaggtacaacagcaaccaagaagatcgatgtctacctccctctgcactcgagccaggacagactgctgccaatgaccgtggtgacaatggccagcgccagggtgcaggacctgatcgggctcatctgctggcagtatacaagcgaaggacgggagccgaagctcaatgacaatgtcagtgcctactgcctgcatattgctgaggatgatggggaggtggacaccgatttccccccgctggattccaatgagcccattcataagtttggcttcagtactttggccctggttgaaaagtactcatctcctggtctgacatccaaagagtcactctttgttcgaataaatgctgctcatggattctcccttattcaggtggacaacacaaaggttaccatgaaggaaatcttactgaaggcagtgaagcgaagaaaaggatcccagaaagtttcaggttcaagggcagacggggtttttgaggaggattcgcaaattgacatagccacagtacaggatatgcttagcagccaccattacaagtcattcaaagtcagcatgatccacagactgcgattcacaaccgacgtacagctaggtatctctggagacaaagtagagatagaccctgttacgaatcagaaagccagcactaagttttggattaagcagaaacccatctcaatcgattccgacctgctctgtgcctgtgaccttgctgaagagaaaagccccagtcacgcaatatttaaactcacgtatctaagcaatcacgactataaacacctctactttgaatcggacgctgctaccgtcaatgaaattgtgctcaaggttaactacatcctggaatcgcgagctagcactgcccgggctgactactttgctcaaaaacaaagaaaactgaacagacgtacgagcttcagcttccagaaggagaagaaatccgggcagcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphatidylinositol glycan anchor biosynthesis, class V
- glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
- UDP glucuronosyltransferase 1 family, polypeptide A10
- serine palmitoyltransferase, long chain base subunit 2

Buy MAPKAP1-mitogen-activated protein kinase associated protein 1 Gene now

Add to cart