UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene View larger

UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene


New product

Data sheet of UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020971
Product type: DNA & cDNA
Ncbi symbol: UGT1A10
Origin species: Human
Product name: UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene
Size: 2ug
Accessions: BC020971
Gene id: 54575
Gene description: UDP glucuronosyltransferase 1 family, polypeptide A10
Synonyms: UDPGT; UGT-1J; UGT1-10; UGT1.10; UGT1J; UDP-glucuronosyltransferase 1-10; UDP glucuronosyltransferase 1 family, polypeptide A10; UDP glycosyltransferase 1 family, polypeptide A10; UDP-glucuronosyltransferase 1-J; UDP-glucuronosyltransferase 1A10; UDPGT 1-10; UDP glucuronosyltransferase family 1 member A10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcgcgcagggtggaccagccccgttcctttatgtgtgtgtctactgctgacctgtggctttgccgaggcagggaagctgctggtagtgcccatggatgggagtcactggttcaccatgcagtcggtggtggagaaacttatcctcagggggcatgaggtggttgtagtcatgccagaggtgagttggcaactggaaagatcactgaattgcacagtgaagacttactcaacctcgtacactctggaagatcagaaccgggaattcatggttttcgcccatgctcaatggaaagcacaggcacaaagtatattttctctattaatgagttcatccagtggttttcttgacttatttttttcgcattgcaggagtttgtttaatgaccgaaaattagtagaatacttaaaggagagttcttttgatgcagtgtttctggatccttttgatacctgtggcttaattgttgctaaatatttctccctcccctctgtggtcttcaccaggggaatattttgccaccatcttgaagaaggtgcacagtgccctgctcctctttcctatgtccccaatgatctcttagggttctcagatgccatgactttcaaggagagagtatggaaccacatcgtgcacttggaggaccatttattttgccagtatctttttagaaatgccctagaaatagcctctgaaattctccaaacccctgtcacggcatatgatctctacagtcacacatcaatttggttgttgcgaacggactttgttttggactatcccaaacccgtgatgcccaacatgatcttcattggtggtatcaactgtcatcagggaaagccattgcctatggaatttgaagcctacattaatgcttctggagaacatggaattgtggttttctctttgggatcaatggtctcagaaattccagagaagaaagctatggcaattgctgatgctttgggcaaaatccctcagacagtcctgtggcggtacactggaacccgaccatcgaatcttgcgaacaacacgatacttgttaagtggctaccccaaaacgatctgcttggtcacccgatgacccgtgcctttatcacccatgctggttcccatggtgtttatgaaagcatatgcaatggcgttcccatggtgatgatgcccttgtttggtgatcagatggacaatgcaaagcgcatggagactaagggagctggagtgaccctgaatgttctggaaatgacttctgaagatttagaaaatgctctaaaagcagtcatcaatgacaaaagttacaaggagaacatcatgcgcctctccagccttcacaaggaccgcccggtggagccgctggacctggccgtgttctgggtggagtttgtgatgaggcacaagggcgcgccacacctgcgccccgcagcccacgacctcacctggtaccagtaccattccttggacgtgattggtttcctcttggccgtcgtgctgacagtggccttcatcacctttaaatgttgtgcttatggctaccggaaatgcttggggaaaaaagggcgagttaagaaagcccacaaatccaagacccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine palmitoyltransferase, long chain base subunit 2
- pescadillo homolog 1, containing BRCT domain (zebrafish)
- synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
- pseudouridylate synthase 7 homolog (S. cerevisiae)-like

Buy UGT1A10-UDP glucuronosyltransferase 1 family, polypeptide A10 Gene now

Add to cart