Login to display prices
Login to display prices
ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene View larger

ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene

PTXBC037283

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene

Proteogenix catalog: PTXBC037283
Ncbi symbol: ZMPSTE24
Product name: ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene
Size: 2ug
Accessions: BC037283
Gene id: 10269
Gene description: zinc metallopeptidase (STE24 homolog, S. cerevisiae)
Synonyms: FACE-1; FACE1; HGPS; PRO1; STE24; Ste24p; CAAX prenyl protease 1 homolog; farnesylated proteins-converting enzyme 1; prenyl protein-specific endoprotease 1; zinc metallopeptidase STE24 homolog; zinc metalloproteinase Ste24 homolog; zinc metallopeptidase STE24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggatgtgggcatcgctggacgctttgtgggagatgccggccgagaagcgtatcttcggggccgtgctgctcttttcctggacagtgtatctttgggagaccttcctagcacagcggcagagaaggatatataaaacaacaactcatgtaccaccggagttaggacagatcatggattctgaaacatttgagaaatctcgactctatcaactggataaaagcactttcagcttctggtcaggactctattcagagactgaaggcactcttattcttctctttggaggaataccttatctctggagactttctggacggttctgtggttatgctggctttggaccagaatatgagatcactcagtccctggtgtttctgctgttggctacacttttcagtgcattggctggtttgccatggagtctttataatacttttgtgatagaagaaaaacatggcttcaatcaacagactttggggttcttcatgaaagatgcaatcaagaaatttgttgtgactcagtgcattttgttgcctgtgtcttcacttctactttacattattaaaattgggggtgactatttttttatttatgcctggctgttcacattagttgtgtctctggttcttgtcacaatctatgctgattatattgcccctttatttgacaaattcacacctctgcctgagggaaagcttaaagaagaaattgaagtaatggcaaagagtattgactttcctttgacgaaggtgtatgttgtggaaggatctaaacgctcttcccacagcaatgcttatttttatggcttcttcaagaacaagcgaatagttttgtttgacactctactagaagagtactctgtactaaacaaagacatccaggaggattctggcatggaaccccgcaatgaggaagaagggaacagtgaagaaataaaagctaaagttaaaaataagaaacaaggatgtaaaaatgaggaggtactcgctgtactaggccatgaactggggcactggaagttgggacatacagtcaaaaatatcattattagccagatgaattctttcctgtgtttttttttatttgctgtattaattggtcgaaaggagctttttgctgcatttggtttttatgatagccaacccactcttattggactattgatcatcttccagtttattttttcaccttacaatgaggttctttctttttgcctaacagtcctaagccgcagatttgagtttcaagctgatgcatttgccaagaaacttgggaaggctaaagacttatattctgctttaatcaaacttaacaaagataacttgggattccctgtttctgactggttgttctcaatgtggcattattctcatcctccactgctagagagacttcaagctttgaaaactatgaagcaacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: