ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene View larger

ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene

PTXBC037283

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037283
Product type: DNA & cDNA
Ncbi symbol: ZMPSTE24
Origin species: Human
Product name: ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene
Size: 2ug
Accessions: BC037283
Gene id: 10269
Gene description: zinc metallopeptidase (STE24 homolog, S. cerevisiae)
Synonyms: FACE-1; FACE1; HGPS; PRO1; STE24; Ste24p; CAAX prenyl protease 1 homolog; farnesylated proteins-converting enzyme 1; prenyl protein-specific endoprotease 1; zinc metallopeptidase STE24 homolog; zinc metalloproteinase Ste24 homolog; zinc metallopeptidase STE24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggatgtgggcatcgctggacgctttgtgggagatgccggccgagaagcgtatcttcggggccgtgctgctcttttcctggacagtgtatctttgggagaccttcctagcacagcggcagagaaggatatataaaacaacaactcatgtaccaccggagttaggacagatcatggattctgaaacatttgagaaatctcgactctatcaactggataaaagcactttcagcttctggtcaggactctattcagagactgaaggcactcttattcttctctttggaggaataccttatctctggagactttctggacggttctgtggttatgctggctttggaccagaatatgagatcactcagtccctggtgtttctgctgttggctacacttttcagtgcattggctggtttgccatggagtctttataatacttttgtgatagaagaaaaacatggcttcaatcaacagactttggggttcttcatgaaagatgcaatcaagaaatttgttgtgactcagtgcattttgttgcctgtgtcttcacttctactttacattattaaaattgggggtgactatttttttatttatgcctggctgttcacattagttgtgtctctggttcttgtcacaatctatgctgattatattgcccctttatttgacaaattcacacctctgcctgagggaaagcttaaagaagaaattgaagtaatggcaaagagtattgactttcctttgacgaaggtgtatgttgtggaaggatctaaacgctcttcccacagcaatgcttatttttatggcttcttcaagaacaagcgaatagttttgtttgacactctactagaagagtactctgtactaaacaaagacatccaggaggattctggcatggaaccccgcaatgaggaagaagggaacagtgaagaaataaaagctaaagttaaaaataagaaacaaggatgtaaaaatgaggaggtactcgctgtactaggccatgaactggggcactggaagttgggacatacagtcaaaaatatcattattagccagatgaattctttcctgtgtttttttttatttgctgtattaattggtcgaaaggagctttttgctgcatttggtttttatgatagccaacccactcttattggactattgatcatcttccagtttattttttcaccttacaatgaggttctttctttttgcctaacagtcctaagccgcagatttgagtttcaagctgatgcatttgccaagaaacttgggaaggctaaagacttatattctgctttaatcaaacttaacaaagataacttgggattccctgtttctgactggttgttctcaatgtggcattattctcatcctccactgctagagagacttcaagctttgaaaactatgaagcaacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - asparaginyl-tRNA synthetase 2, mitochondrial (putative)
- phosphatidylinositol glycan anchor biosynthesis, class A
- mitogen-activated protein kinase associated protein 1
- phosphatidylinositol glycan anchor biosynthesis, class V

Buy ZMPSTE24-zinc metallopeptidase (STE24 homolog, S. cerevisiae) Gene now

Add to cart