MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene View larger

MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene

PTXBC007318

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007318
Product type: DNA & cDNA
Ncbi symbol: MAPRE2
Origin species: Human
Product name: MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene
Size: 2ug
Accessions: BC007318
Gene id: 10982
Gene description: microtubule-associated protein, RP/EB family, member 2
Synonyms: CSCSC2; EB1; EB2; RP1; microtubule-associated protein RP/EB family member 2; APC-binding protein EB1; APC-binding protein EB2; T-cell activation protein, EB1 family; end-binding protein 2; microtubule associated protein RP/EB family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgggccgacccaaaccctgtccccaaatggcgagaacaacaacgacatcatccaggataataacgggaccatcattcctttccggaagcacacagtgcgcggggagcgttcctacagttggggaatggcggtcaatgtgtattctacctcgataacccaagagactatgagcagacatgacatcattgcatgggttaatgacatagtatctttaaactacacaaaagtggaacagctttgttcaggagcggcctattgccaattcatggacatgctcttccctggctgcattagtttgaagaaagtaaaatttcaagcaaagctggaacatgaatatattcacaattttaaacttctgcaagcatcatttaagcgaatgaacgttgataaggtaattccagtggagaagctagtgaaaggacgtttccaggacaacctggattttattcaatggtttaagaaattctatgatgctaactacgatgggaaggagtatgatcctgtagaggcacgacaagggcaagatgcaattcctcctcctgaccctggtgaacagatcttcaacctgccaaaaaagtctcaccatgcaaactcccccacagcaggtgcagctaaatcaagtccagcagctaaaccaggatccacaccttctcgaccctcatcagccaaaagggcttcttccagtggctcagcatccaaatccgataaagatttagaaacgcaggtcatacagcttaatgaacaggtacattcattaaaacttgcccttgaaggcgtggaaaaggaaagggatttctactttgggaagttgagagagatcgagctactctgccaagaacacgggcaggaaaatgatgacctcgtgcagagactaatggacatcctgtatgcttcagaagaacacgagggccacacagaagagccggaagcagaggagcaagcccacgaacagcagcccccgcagcaggaagagtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 30 (zinc transporter), member 3
- eukaryotic translation initiation factor 4A, isoform 1
- carbohydrate (keratan sulfate Gal-6) sulfotransferase 1
- phosphatidylinositol glycan anchor biosynthesis, class M

Buy MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene now

Add to cart