Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene
PTXBC007318
New product
Data sheet of MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007318 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAPRE2 |
| Origin species: | Human |
| Product name: | MAPRE2-microtubule-associated protein, RP/EB family, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC007318 |
| Gene id: | 10982 |
| Gene description: | microtubule-associated protein, RP/EB family, member 2 |
| Synonyms: | CSCSC2; EB1; EB2; RP1; microtubule-associated protein RP/EB family member 2; APC-binding protein EB1; APC-binding protein EB2; T-cell activation protein, EB1 family; end-binding protein 2; microtubule associated protein RP/EB family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgggccgacccaaaccctgtccccaaatggcgagaacaacaacgacatcatccaggataataacgggaccatcattcctttccggaagcacacagtgcgcggggagcgttcctacagttggggaatggcggtcaatgtgtattctacctcgataacccaagagactatgagcagacatgacatcattgcatgggttaatgacatagtatctttaaactacacaaaagtggaacagctttgttcaggagcggcctattgccaattcatggacatgctcttccctggctgcattagtttgaagaaagtaaaatttcaagcaaagctggaacatgaatatattcacaattttaaacttctgcaagcatcatttaagcgaatgaacgttgataaggtaattccagtggagaagctagtgaaaggacgtttccaggacaacctggattttattcaatggtttaagaaattctatgatgctaactacgatgggaaggagtatgatcctgtagaggcacgacaagggcaagatgcaattcctcctcctgaccctggtgaacagatcttcaacctgccaaaaaagtctcaccatgcaaactcccccacagcaggtgcagctaaatcaagtccagcagctaaaccaggatccacaccttctcgaccctcatcagccaaaagggcttcttccagtggctcagcatccaaatccgataaagatttagaaacgcaggtcatacagcttaatgaacaggtacattcattaaaacttgcccttgaaggcgtggaaaaggaaagggatttctactttgggaagttgagagagatcgagctactctgccaagaacacgggcaggaaaatgatgacctcgtgcagagactaatggacatcctgtatgcttcagaagaacacgagggccacacagaagagccggaagcagaggagcaagcccacgaacagcagcccccgcagcaggaagagtactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 30 (zinc transporter), member 3 - eukaryotic translation initiation factor 4A, isoform 1 - carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 - phosphatidylinositol glycan anchor biosynthesis, class M |