SLC30A3-solute carrier family 30 (zinc transporter), member 3 Gene View larger

SLC30A3-solute carrier family 30 (zinc transporter), member 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC30A3-solute carrier family 30 (zinc transporter), member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC30A3-solute carrier family 30 (zinc transporter), member 3 Gene

Proteogenix catalog: PTXBC028358
Ncbi symbol: SLC30A3
Product name: SLC30A3-solute carrier family 30 (zinc transporter), member 3 Gene
Size: 2ug
Accessions: BC028358
Gene id: 7781
Gene description: solute carrier family 30 (zinc transporter), member 3
Synonyms: ZNT3; zinc transporter 3; solute carrier family 30 (zinc transporter), member 3; zinc transporter ZnT-3; znT-3; solute carrier family 30 member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccctctccagccgctgggggcttggagaccactcgcctggtgagcccccgggaccgcggtggcgccggaggcagcctgcgtttgaagagtctcttcacagagccctcagagcccctccctgaggagtccaaacctgtggagatgcccttccaccactgccacagggacccccttccgccgccgggccttacccctgagaggctgcatgcacggaggcagctatatgctgcctgtgccgtttgctttgtcttcatggctggggaggtggtcggcgggtatctggcacacagcctggccatcatgaccgatgcagcccacttgctggcggatgtgggcagcatgatgggcagcctcttctccctctggctctccacccgtccagccacccgcaccatgacctttggctggcaccgttcagagactctgggggctttggcctctgtggtctccctctggatggtcactggcatcctcctgtacctggccttcgtccgcctgctgcacagcgactaccacatcgaggggggtgccatgctgctgaccgccagcatcgcagtctgtgccaacctgttaatggcctttgtgctgcaccaggctgggcccccccacagccacgggtctaggggagcagagtatgcaccgctggaggaggggcctgaagagcccctgcccctggggaacaccagcgtccgggcggcatttgtgcacgtgctgggggacctcctgcagagctttggggtactggctgcctccatcctcatctacttcaagcctcaatacaaggcagccgaccccatcagcaccttcctcttctccatctgtgcccttggatccaccgctcccaccctccgagacgttcttcgaatcctcatggaaggtaccccccgcaatgtggggttcgaacctgtgcgggatacgctgttgtcggtgccaggagtccgggcaacccatgagctgcacctgtgggcccttacgctcacttaccatgttgcctctgcacacctggccatcgactccaccgctgaccctgaagccgtcctggctgaagcctcatcccggctctactcccggtttggattctccagctgcaccctgcaggtcgagcagtatcagccggagatggcccagtgcctgcgctgccaggaacccccccaagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice