Login to display prices
Login to display prices
EIF4A1-eukaryotic translation initiation factor 4A, isoform 1 Gene View larger

EIF4A1-eukaryotic translation initiation factor 4A, isoform 1 Gene

PTXBC009585

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF4A1-eukaryotic translation initiation factor 4A, isoform 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF4A1-eukaryotic translation initiation factor 4A, isoform 1 Gene

Proteogenix catalog: PTXBC009585
Ncbi symbol: EIF4A1
Product name: EIF4A1-eukaryotic translation initiation factor 4A, isoform 1 Gene
Size: 2ug
Accessions: BC009585
Gene id: 1973
Gene description: eukaryotic translation initiation factor 4A, isoform 1
Synonyms: DDX2A; EIF-4A; EIF4A; eIF-4A-I; eIF4A-I; eukaryotic initiation factor 4A-I; ATP-dependent RNA helicase eIF4A-1; eukaryotic initiation factor 4AI; eukaryotic translation initiation factor 4A; eukaryotic translation initiation factor 4A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgcgagccaggattcccgatccagagacaatggccccgatgggatggagcccgaaggcgtcatcgagagtaactggaatgagattgttgacagctttgatgacatgaacctctcggagtcccttctccgtggcatctacgcctatggttttgagaagccctctgccatccagcagcgagccattctaccttgtatcaagggttatgatgtgattgctcaagcccaatctgggactgggaaaacggccacatttgccatatcaattctgcagcagattgaattagatctaaaagccacccaggccttggtcctagcacccactcgagaattggctcagcagatacagaaggtggtcatggcactaggagactacatgggcgcctcctgtcacgcctgtatcgggggcaccaacgtgcgtgctgaggtgcagaaactgcagatggaagctccccacatcatcgtgggtacccctggccgtgtgtttgatatgcttaaccggagatacctgtcccccaaatacatcaagatgtttgtactggatgaagctgacgaaatgttaagccgtggattcaaggaccagatctatgacatattccaaaagctcaacagcaacacccaggtagttttgctgtcagccacaatgccttctgatgtgcttgaggtgaccaagaagttcatgagggaccccattcggattcttgtcaagaaggaagagttgaccctggagggtatccgccagttctacatcaacgtggaacgagaggagtggaagctggacacactatgtgacttgtatgaaaccctgaccatcacccaggcagtcatcttcatcaacacccggaggaaggtggactggctcaccgagaagatgcatgctcgagatttcactgtatccgccatgcatggagatatggaccaaaaggaacgagacgtgattatgagggagtttcgttctggctctagcagagttttgattaccactgacctgctggccagaggcattgatgtgcagcaggtttctttagtcatcaactatgaccttcccaccaacagggaaaactatatccacagaatcggtcgaggtggacggtttggccgtaaaggtgtggctattaacatggtgacagaagaagacaagaggactcttcgagacattgagaccttctacaacacctccattgaggaaatgcccctcaatgttgctgacctcatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: