Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EIF4A1-eukaryotic translation initiation factor 4A, isoform 1 Gene
PTXBC009585
New product
Data sheet of EIF4A1-eukaryotic translation initiation factor 4A, isoform 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF4A1-eukaryotic translation initiation factor 4A, isoform 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009585 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF4A1 |
| Origin species: | Human |
| Product name: | EIF4A1-eukaryotic translation initiation factor 4A, isoform 1 Gene |
| Size: | 2ug |
| Accessions: | BC009585 |
| Gene id: | 1973 |
| Gene description: | eukaryotic translation initiation factor 4A, isoform 1 |
| Synonyms: | DDX2A; EIF-4A; EIF4A; eIF-4A-I; eIF4A-I; eukaryotic initiation factor 4A-I; ATP-dependent RNA helicase eIF4A-1; eukaryotic initiation factor 4AI; eukaryotic translation initiation factor 4A; eukaryotic translation initiation factor 4A1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgcgagccaggattcccgatccagagacaatggccccgatgggatggagcccgaaggcgtcatcgagagtaactggaatgagattgttgacagctttgatgacatgaacctctcggagtcccttctccgtggcatctacgcctatggttttgagaagccctctgccatccagcagcgagccattctaccttgtatcaagggttatgatgtgattgctcaagcccaatctgggactgggaaaacggccacatttgccatatcaattctgcagcagattgaattagatctaaaagccacccaggccttggtcctagcacccactcgagaattggctcagcagatacagaaggtggtcatggcactaggagactacatgggcgcctcctgtcacgcctgtatcgggggcaccaacgtgcgtgctgaggtgcagaaactgcagatggaagctccccacatcatcgtgggtacccctggccgtgtgtttgatatgcttaaccggagatacctgtcccccaaatacatcaagatgtttgtactggatgaagctgacgaaatgttaagccgtggattcaaggaccagatctatgacatattccaaaagctcaacagcaacacccaggtagttttgctgtcagccacaatgccttctgatgtgcttgaggtgaccaagaagttcatgagggaccccattcggattcttgtcaagaaggaagagttgaccctggagggtatccgccagttctacatcaacgtggaacgagaggagtggaagctggacacactatgtgacttgtatgaaaccctgaccatcacccaggcagtcatcttcatcaacacccggaggaaggtggactggctcaccgagaagatgcatgctcgagatttcactgtatccgccatgcatggagatatggaccaaaaggaacgagacgtgattatgagggagtttcgttctggctctagcagagttttgattaccactgacctgctggccagaggcattgatgtgcagcaggtttctttagtcatcaactatgaccttcccaccaacagggaaaactatatccacagaatcggtcgaggtggacggtttggccgtaaaggtgtggctattaacatggtgacagaagaagacaagaggactcttcgagacattgagaccttctacaacacctccattgaggaaatgcccctcaatgttgctgacctcatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 - phosphatidylinositol glycan anchor biosynthesis, class M - solute carrier family 39 (zinc transporter), member 8 - zinc metallopeptidase (STE24 homolog, S. cerevisiae) |