Cart 1 Product Products 113,40 € (empty)
-
1 x KCTD14-pot...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
SLC30A2-solute carrier family 30 (zinc transporter), member 2 Gene
PTXBC006251
New product
Data sheet of SLC30A2-solute carrier family 30 (zinc transporter), member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC30A2-solute carrier family 30 (zinc transporter), member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006251 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC30A2 |
| Origin species: | Human |
| Product name: | SLC30A2-solute carrier family 30 (zinc transporter), member 2 Gene |
| Size: | 2ug |
| Accessions: | BC006251 |
| Gene id: | 7780 |
| Gene description: | solute carrier family 30 (zinc transporter), member 2 |
| Synonyms: | PP12488; TNZD; ZNT2; ZnT-2; zinc transporter 2; solute carrier family 30 (zinc transporter), member 2; solute carrier family 30 member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggccaaggagaagcagcatctgttggacgccaggccggcaatccggtcatacacgggatctctgtggcaggaaggggctggctggattcctctgccccgacctggcctggacttgcaggccattgagctggctgcccagagcaaccatcactgccatgctcagaagggtcctgacagtcactgtgaccccaagaaggggaaggcccagcgccagctgtatgtagcctctgccatctgcctgttgttcatgatcggagaagtcgttgagatcttgggagccctggtctctgtactgtccatctgggtcgtgacgggggtactggtgtacctggctgtggagcggctgatctctggggactatgaaattgacggggggaccatgctgatcacgtcgggctgcgctgtggctgtgaacatcataatggggttgacccttcaccagtctggccatgggcacagccacggcaccaccaaccagcaggaggagaaccccagcgtccgagctgccttcatccatgtgatcggcgactttatgcagagcatgggtgtcctagtggcagcctatattttatacttcaagccagaatacaagtatgtagaccccatctgcaccttcgtcttctccatcctggtcctggggacaaccttgaccatcctgagagatgtgatcctggtgttgatggaagggacccccaagggcgttgacttcacagctgttcgtgatctgctgctgtcggtggagggggtagaagccctgcacagcctgcatatctgggcactgacggtggcccagcctgttctgtctgtccacatcgccattgctcagaatacagacgcccaggctgtgctgaagacagccagcagccgcctccaagggaagttccacttccacaccgtgaccatccagatcgaggactactcggaggacatgaaggactgtcaggcatgccagggcccctcagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2A activator, regulatory subunit 4 - solute carrier family 39 (zinc transporter), member 1 - protein phosphatase 1, catalytic subunit, beta isoform - microtubule-associated protein, RP/EB family, member 2 |