TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene View larger

TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008042
Product type: DNA & cDNA
Ncbi symbol: TNFSF13
Origin species: Human
Product name: TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene
Size: 2ug
Accessions: BC008042
Gene id: 8741
Gene description: tumor necrosis factor (ligand) superfamily, member 13
Synonyms: APRIL; CD256; TALL-2; TALL2; TNLG7B; TRDL-1; UNQ383/PRO715; ZTNF2; tumor necrosis factor ligand superfamily member 13; TNF- and APOL-related leukocyte expressed ligand 2; a proliferation-inducing ligand; tumor necrosis factor (ligand) superfamily, member 13; tumor necrosis factor ligand 7B; tumor necrosis factor-like protein ZTNF2; tumor necrosis factor-related death ligand-1; tumor necrosis factor superfamily member 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagcctcatctcctttcttgctagcccccaaagggcctccaggcaacatggggggcccagtcagagagccggcactctcagttgccctctggttgagttggggggcagctctgggggccgtggcttgtgccatggctctgctgacccaacaaacagagctgcagagcctcaggagagaggtgagccggctgcaggggacaggaggcccctcccagaatggggaagggtatccctggcagagtctcccggagcagagttccgatgccctggaagcctgggagagtggggagagatcccggaaaaggagagcagtgctcacccaaaaacagaagaagcagcactctgtcctgcacctggttcccattaacgccacctccaaggatgactccgatgtgacagaggtgatgtggcaaccagctcttaggcgtgggagaggcctacaggcccaaggatatggtgtccgaatccaggatgctggagtttatctgctgtatagccaggtcctgtttcaagacgtgactttcaccatgggtcaggtggtgtctcgagaaggccaaggaaggcaggagactctattccgatgtataagaagtatgccctcccacccggaccgggcctacaacagctgctatagcgcaggtgtcttccatttacaccaaggggatattctgagtgtcataattccccgggcaagggcgaaacttaacctctctccacatggaaccttcctgggactttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium channel tetramerisation domain containing 17
- microtubule-associated protein, RP/EB family, member 3
- solute carrier family 30 (zinc transporter), member 2
- protein phosphatase 2A activator, regulatory subunit 4

Buy TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene now

Add to cart