Login to display prices
Login to display prices
TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene View larger

TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene

PTXBC008042

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene

Proteogenix catalog: PTXBC008042
Ncbi symbol: TNFSF13
Product name: TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene
Size: 2ug
Accessions: BC008042
Gene id: 8741
Gene description: tumor necrosis factor (ligand) superfamily, member 13
Synonyms: APRIL; CD256; TALL-2; TALL2; TNLG7B; TRDL-1; UNQ383/PRO715; ZTNF2; tumor necrosis factor ligand superfamily member 13; TNF- and APOL-related leukocyte expressed ligand 2; a proliferation-inducing ligand; tumor necrosis factor (ligand) superfamily, member 13; tumor necrosis factor ligand 7B; tumor necrosis factor-like protein ZTNF2; tumor necrosis factor-related death ligand-1; tumor necrosis factor superfamily member 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagcctcatctcctttcttgctagcccccaaagggcctccaggcaacatggggggcccagtcagagagccggcactctcagttgccctctggttgagttggggggcagctctgggggccgtggcttgtgccatggctctgctgacccaacaaacagagctgcagagcctcaggagagaggtgagccggctgcaggggacaggaggcccctcccagaatggggaagggtatccctggcagagtctcccggagcagagttccgatgccctggaagcctgggagagtggggagagatcccggaaaaggagagcagtgctcacccaaaaacagaagaagcagcactctgtcctgcacctggttcccattaacgccacctccaaggatgactccgatgtgacagaggtgatgtggcaaccagctcttaggcgtgggagaggcctacaggcccaaggatatggtgtccgaatccaggatgctggagtttatctgctgtatagccaggtcctgtttcaagacgtgactttcaccatgggtcaggtggtgtctcgagaaggccaaggaaggcaggagactctattccgatgtataagaagtatgccctcccacccggaccgggcctacaacagctgctatagcgcaggtgtcttccatttacaccaaggggatattctgagtgtcataattccccgggcaagggcgaaacttaacctctctccacatggaaccttcctgggactttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: