Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene
PTXBC008042
New product
Data sheet of TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008042 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFSF13 |
| Origin species: | Human |
| Product name: | TNFSF13-tumor necrosis factor (ligand) superfamily, member 13 Gene |
| Size: | 2ug |
| Accessions: | BC008042 |
| Gene id: | 8741 |
| Gene description: | tumor necrosis factor (ligand) superfamily, member 13 |
| Synonyms: | APRIL; CD256; TALL-2; TALL2; TNLG7B; TRDL-1; UNQ383/PRO715; ZTNF2; tumor necrosis factor ligand superfamily member 13; TNF- and APOL-related leukocyte expressed ligand 2; a proliferation-inducing ligand; tumor necrosis factor (ligand) superfamily, member 13; tumor necrosis factor ligand 7B; tumor necrosis factor-like protein ZTNF2; tumor necrosis factor-related death ligand-1; tumor necrosis factor superfamily member 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagcctcatctcctttcttgctagcccccaaagggcctccaggcaacatggggggcccagtcagagagccggcactctcagttgccctctggttgagttggggggcagctctgggggccgtggcttgtgccatggctctgctgacccaacaaacagagctgcagagcctcaggagagaggtgagccggctgcaggggacaggaggcccctcccagaatggggaagggtatccctggcagagtctcccggagcagagttccgatgccctggaagcctgggagagtggggagagatcccggaaaaggagagcagtgctcacccaaaaacagaagaagcagcactctgtcctgcacctggttcccattaacgccacctccaaggatgactccgatgtgacagaggtgatgtggcaaccagctcttaggcgtgggagaggcctacaggcccaaggatatggtgtccgaatccaggatgctggagtttatctgctgtatagccaggtcctgtttcaagacgtgactttcaccatgggtcaggtggtgtctcgagaaggccaaggaaggcaggagactctattccgatgtataagaagtatgccctcccacccggaccgggcctacaacagctgctatagcgcaggtgtcttccatttacaccaaggggatattctgagtgtcataattccccgggcaagggcgaaacttaacctctctccacatggaaccttcctgggactttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium channel tetramerisation domain containing 17 - microtubule-associated protein, RP/EB family, member 3 - solute carrier family 30 (zinc transporter), member 2 - protein phosphatase 2A activator, regulatory subunit 4 |