Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MOBKL2B-MOB1, Mps One Binder kinase activator-like 2B (yeast) Gene
PTXBC033027
New product
Data sheet of MOBKL2B-MOB1, Mps One Binder kinase activator-like 2B (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MOBKL2B-MOB1, Mps One Binder kinase activator-like 2B (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033027 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MOBKL2B |
| Origin species: | Human |
| Product name: | MOBKL2B-MOB1, Mps One Binder kinase activator-like 2B (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC033027 |
| Gene id: | 79817 |
| Gene description: | MOB1, Mps One Binder kinase activator-like 2B (yeast) |
| Synonyms: | MOBKL2B; C9orf35; MOB1D; MOB kinase activator 3B; MOB1, Mps One Binder kinase activator-like 2B; mob1 homolog 2b; monopolar spindle 1 binding, MOB1, domain containing; mps one binder kinase activator-like 2B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccatagccctgaagcaggtattcaacaaggacaagaccttccgacccaagaggaaatttgaacctggcacacagaggtttgagctgcacaaacgggctcaggcatccctcaactcgggtgtggacctgaaggcggctgtgcagttgcccagtggggaggaccagaatgactgggtggcagtacatgtggtggacttcttcaatcggatcaacctcatctatggcaccatctgtgagttctgcaccgagcggacctgtcctgtgatgtcagggggccccaaatatgagtatcggtggcaggatgatctcaagtataagaagccaacagcgctgccagctccccagtacatgaaccttcttatggattggattgaggttcagatcaacaacgaggaaatatttccaacatgcgtgggtgttcccttcccaaagaacttccttcagatctgcatgaagatcctgtgccgccttttccgggtctttgtccacgtctatatccaccacttcgaccgggtcattgtgatgggtgcagaggcccatgtcaacacctgctacaaacacttctattactttgtcacagagatgaacctcatagaccgcaaggagctagagcctttgaaagaaatgacgagcaggatgtgtcactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 30 (zinc transporter), member 6 - potassium channel tetramerisation domain containing 14 - tumor necrosis factor (ligand) superfamily, member 13 - potassium channel tetramerisation domain containing 17 |