Login to display prices
Login to display prices
MOBKL2B-MOB1, Mps One Binder kinase activator-like 2B (yeast) Gene View larger

MOBKL2B-MOB1, Mps One Binder kinase activator-like 2B (yeast) Gene

PTXBC033027

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MOBKL2B-MOB1, Mps One Binder kinase activator-like 2B (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MOBKL2B-MOB1, Mps One Binder kinase activator-like 2B (yeast) Gene

Proteogenix catalog: PTXBC033027
Ncbi symbol: MOBKL2B
Product name: MOBKL2B-MOB1, Mps One Binder kinase activator-like 2B (yeast) Gene
Size: 2ug
Accessions: BC033027
Gene id: 79817
Gene description: MOB1, Mps One Binder kinase activator-like 2B (yeast)
Synonyms: MOBKL2B; C9orf35; MOB1D; MOB kinase activator 3B; MOB1, Mps One Binder kinase activator-like 2B; mob1 homolog 2b; monopolar spindle 1 binding, MOB1, domain containing; mps one binder kinase activator-like 2B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccatagccctgaagcaggtattcaacaaggacaagaccttccgacccaagaggaaatttgaacctggcacacagaggtttgagctgcacaaacgggctcaggcatccctcaactcgggtgtggacctgaaggcggctgtgcagttgcccagtggggaggaccagaatgactgggtggcagtacatgtggtggacttcttcaatcggatcaacctcatctatggcaccatctgtgagttctgcaccgagcggacctgtcctgtgatgtcagggggccccaaatatgagtatcggtggcaggatgatctcaagtataagaagccaacagcgctgccagctccccagtacatgaaccttcttatggattggattgaggttcagatcaacaacgaggaaatatttccaacatgcgtgggtgttcccttcccaaagaacttccttcagatctgcatgaagatcctgtgccgccttttccgggtctttgtccacgtctatatccaccacttcgaccgggtcattgtgatgggtgcagaggcccatgtcaacacctgctacaaacacttctattactttgtcacagagatgaacctcatagaccgcaaggagctagagcctttgaaagaaatgacgagcaggatgtgtcactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: