SLC30A6-solute carrier family 30 (zinc transporter), member 6 Gene View larger

SLC30A6-solute carrier family 30 (zinc transporter), member 6 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC30A6-solute carrier family 30 (zinc transporter), member 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC30A6-solute carrier family 30 (zinc transporter), member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032525
Product type: DNA & cDNA
Ncbi symbol: SLC30A6
Origin species: Human
Product name: SLC30A6-solute carrier family 30 (zinc transporter), member 6 Gene
Size: 2ug
Accessions: BC032525
Gene id: 55676
Gene description: solute carrier family 30 (zinc transporter), member 6
Synonyms: MST103; MSTP103; ZNT6; zinc transporter 6; solute carrier family 30 (zinc transporter), member 6; solute carrier family 30 member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgtgtacagtgggaaagtcttactccagacaacaccaccccatgttattggtcagttggacaaactcatcagagaggtatctaccttagatggagttttagaagtccgaaatgaacatttttggaccctaggttttggctcattggctggatcagtgcatgtaagaattcgacgagatgccaatgaacaaatggttcttgctcatgtgaccaacaggctgtacactctagtgtctactctaactgttcaaattttcaaggatgactggattaggcctgccttattgtctgggcctgttgcagccaatgtcctaaacttttcagatcatcacgtaatcccaatgcctcttttaaagggtactgatgatttgaacccagttacatcaactccagctaaacctagtagtccacctccagaattttcatttaacactcctgggaaaaatgtgaacccagttattcttctaaacacacaaacaaggccttatggttttggtctcaatcatggacacacaccttacagcagcatgcttaatcaaggacttggagttccaggaattggagcaactcaaggattgaggactggttttacaaatataccaagtagatatggaactaataatagaattggacaaccaagaccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium channel tetramerisation domain containing 14
- tumor necrosis factor (ligand) superfamily, member 13
- potassium channel tetramerisation domain containing 17
- microtubule-associated protein, RP/EB family, member 3

Buy SLC30A6-solute carrier family 30 (zinc transporter), member 6 Gene now

Add to cart