Login to display prices
Login to display prices
SAT2-spermidine/spermine N1-acetyltransferase family member 2 Gene View larger

SAT2-spermidine/spermine N1-acetyltransferase family member 2 Gene

PTXBC011751

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SAT2-spermidine/spermine N1-acetyltransferase family member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SAT2-spermidine/spermine N1-acetyltransferase family member 2 Gene

Proteogenix catalog: PTXBC011751
Ncbi symbol: SAT2
Product name: SAT2-spermidine/spermine N1-acetyltransferase family member 2 Gene
Size: 2ug
Accessions: BC011751
Gene id: 112483
Gene description: spermidine/spermine N1-acetyltransferase family member 2
Synonyms: SSAT2; diamine acetyltransferase 2; diamine N-acetyltransferase 2; polyamine N-acetyltransferase 2; spermidine/spermine N(1)-acetyltransferase 2; thialysine N-epsilon-acetyltransferase; spermidine/spermine N1-acetyltransferase family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttccgtgcggatccgagaggccaaggagggagactgtggagatatcctgaggctgattcgggagctagccgaattcgaaaaactctcggatcaggtgaagatcagtgaagaagccctgagagcagatggctttggagacaatcctttctatcactgtttggtagcagagattcttccagcgcccgggaagctactggggccctgcgtggtgggctatgggatatactatttcatctacagtacatggaagggacgcaccatttatctggaggatatctatgtgatgccggaatatcggggtcaagggattggttccaaaataatcaaaaaggtggctgaggtggccttggataagggctgctcccaattccgcctggccgtcctggactggaaccagagggccatggacttgtacaaggccctaggagcccaagatctgacggaagctgagggctggcacttcttctgctttcaaggagaggcaacgagaaagttggcaggaaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice