Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SAT2-spermidine/spermine N1-acetyltransferase family member 2 Gene
PTXBC011751
New product
Data sheet of SAT2-spermidine/spermine N1-acetyltransferase family member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SAT2-spermidine/spermine N1-acetyltransferase family member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011751 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SAT2 |
| Origin species: | Human |
| Product name: | SAT2-spermidine/spermine N1-acetyltransferase family member 2 Gene |
| Size: | 2ug |
| Accessions: | BC011751 |
| Gene id: | 112483 |
| Gene description: | spermidine/spermine N1-acetyltransferase family member 2 |
| Synonyms: | SSAT2; diamine acetyltransferase 2; diamine N-acetyltransferase 2; polyamine N-acetyltransferase 2; spermidine/spermine N(1)-acetyltransferase 2; thialysine N-epsilon-acetyltransferase; spermidine/spermine N1-acetyltransferase family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttccgtgcggatccgagaggccaaggagggagactgtggagatatcctgaggctgattcgggagctagccgaattcgaaaaactctcggatcaggtgaagatcagtgaagaagccctgagagcagatggctttggagacaatcctttctatcactgtttggtagcagagattcttccagcgcccgggaagctactggggccctgcgtggtgggctatgggatatactatttcatctacagtacatggaagggacgcaccatttatctggaggatatctatgtgatgccggaatatcggggtcaagggattggttccaaaataatcaaaaaggtggctgaggtggccttggataagggctgctcccaattccgcctggccgtcctggactggaaccagagggccatggacttgtacaaggccctaggagcccaagatctgacggaagctgagggctggcacttcttctgctttcaaggagaggcaacgagaaagttggcaggaaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 4A, isoform 2 - TRAF-interacting protein with forkhead-associated domain - MOB1, Mps One Binder kinase activator-like 2B (yeast) - solute carrier family 30 (zinc transporter), member 6 |