Login to display prices
Login to display prices
SLC39A7-solute carrier family 39 (zinc transporter), member 7 Gene View larger

SLC39A7-solute carrier family 39 (zinc transporter), member 7 Gene

PTXBC000645

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC39A7-solute carrier family 39 (zinc transporter), member 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC39A7-solute carrier family 39 (zinc transporter), member 7 Gene

Proteogenix catalog: PTXBC000645
Ncbi symbol: SLC39A7
Product name: SLC39A7-solute carrier family 39 (zinc transporter), member 7 Gene
Size: 2ug
Accessions: BC000645
Gene id: 7922
Gene description: solute carrier family 39 (zinc transporter), member 7
Synonyms: zinc transporter SLC39A7; D6S115E; D6S2244E; H2-KE4; HKE4; KE4; RING5; ZIP7; HLA class II region expressed gene KE4; Ke4 gene, mouse, human homolog of; histidine-rich membrane protein Ke4; really interesting new gene 5 protein; solute carrier family 39 (zinc transporter), member 7; zrt-, Irt-like protein 7; solute carrier family 39 member 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagaggcctgggggccccccactgggtggccgtgggactgctgacctgggcgaccttggggcttctggtggctggactcgggggtcatgacgacctgcacgacgatctgcaagaggacttccatggccacagccacaggcactcacatgaagatttccaccatggccacagccatgcccatggccatggccacactcacgagagcatctggcatggacatacccacgatcacgaccatggacattcacatgaggatttacaccatggccatagccatggctactcccatgagagcctctaccacagaggacatggacatgaccatgagcatagccatggaggctatggggagtctggggctccaggcatcaagcaggacctggatgctgtcactctctgggcttatgcactgggggccacagtgctgatctcagcagctccattttttgtcctcttccttatccccgtggagtcgaactctccccggcatcgctctctacttcagatcttgctcagttttgcttccggtgggctcctgggagatgctttcctgcacctcattcctcatgctcttgaacctcattctcaccacactctggagcaacccggacatggacactcccacagtggccagggccccattctgtctgtgggactgtgggttctcagtggaattgttgcctttcttgtcgtggagaaatttgtgagacatgtgaaaggaggacatggtcacagtcatggacatggacacgctcacagtcatacacgtggaagtcatggacatggaagacaagagcgttctaccaaggagaagcagagctcagaggaagaagaaaaggaaacaagaggggttcagaagaggcgaggagggagcacagtacccaaagatgggccagtgagacctcagaacgctgaagaagaaaaaagaggcttagacctgcgtgtgtcggggtacctgaatctggctgctgacttggcacacaacttcactgatggtctggccattggggcttcctttcgagggggccggggactagggatcctgaccacaatgactgtcctgctacatgaagtgccccacgaggtcggagactttgccatcttggtccagtctggctgcagcaaaaagcaggcgatgcgtctgcaactactgacagcagtaggggcactggcaggcacagcctgtgcccttctcactgaaggaggagcagtgggcagtgaaattgcaggtggtgcaggtcctggctgggtcctgccatttactgcaggtggctttatctacgtagcaacagtgtctgtgttgcccgagctgctgagggaggcatcaccattgcaatcacttctggaggtgctggggctgctggggggagttatcatgatggtgctgattgcccaccttgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: