Cart 3 Product Products 348,30 € (empty)
-
1 x ALMS1P-Als...113,40 € -
1 x BCDIN3D-BC...121,50 € -
1 x CCNL1-cycl...113,40 €
No products
To be determined Shipping
348,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 348,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 348,30 €
View larger 
SLC39A7-solute carrier family 39 (zinc transporter), member 7 Gene
PTXBC000645
New product
Data sheet of SLC39A7-solute carrier family 39 (zinc transporter), member 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC39A7-solute carrier family 39 (zinc transporter), member 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000645 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC39A7 |
| Origin species: | Human |
| Product name: | SLC39A7-solute carrier family 39 (zinc transporter), member 7 Gene |
| Size: | 2ug |
| Accessions: | BC000645 |
| Gene id: | 7922 |
| Gene description: | solute carrier family 39 (zinc transporter), member 7 |
| Synonyms: | zinc transporter SLC39A7; D6S115E; D6S2244E; H2-KE4; HKE4; KE4; RING5; ZIP7; HLA class II region expressed gene KE4; Ke4 gene, mouse, human homolog of; histidine-rich membrane protein Ke4; really interesting new gene 5 protein; solute carrier family 39 (zinc transporter), member 7; zrt-, Irt-like protein 7; solute carrier family 39 member 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagaggcctgggggccccccactgggtggccgtgggactgctgacctgggcgaccttggggcttctggtggctggactcgggggtcatgacgacctgcacgacgatctgcaagaggacttccatggccacagccacaggcactcacatgaagatttccaccatggccacagccatgcccatggccatggccacactcacgagagcatctggcatggacatacccacgatcacgaccatggacattcacatgaggatttacaccatggccatagccatggctactcccatgagagcctctaccacagaggacatggacatgaccatgagcatagccatggaggctatggggagtctggggctccaggcatcaagcaggacctggatgctgtcactctctgggcttatgcactgggggccacagtgctgatctcagcagctccattttttgtcctcttccttatccccgtggagtcgaactctccccggcatcgctctctacttcagatcttgctcagttttgcttccggtgggctcctgggagatgctttcctgcacctcattcctcatgctcttgaacctcattctcaccacactctggagcaacccggacatggacactcccacagtggccagggccccattctgtctgtgggactgtgggttctcagtggaattgttgcctttcttgtcgtggagaaatttgtgagacatgtgaaaggaggacatggtcacagtcatggacatggacacgctcacagtcatacacgtggaagtcatggacatggaagacaagagcgttctaccaaggagaagcagagctcagaggaagaagaaaaggaaacaagaggggttcagaagaggcgaggagggagcacagtacccaaagatgggccagtgagacctcagaacgctgaagaagaaaaaagaggcttagacctgcgtgtgtcggggtacctgaatctggctgctgacttggcacacaacttcactgatggtctggccattggggcttcctttcgagggggccggggactagggatcctgaccacaatgactgtcctgctacatgaagtgccccacgaggtcggagactttgccatcttggtccagtctggctgcagcaaaaagcaggcgatgcgtctgcaactactgacagcagtaggggcactggcaggcacagcctgtgcccttctcactgaaggaggagcagtgggcagtgaaattgcaggtggtgcaggtcctggctgggtcctgccatttactgcaggtggctttatctacgtagcaacagtgtctgtgttgcccgagctgctgagggaggcatcaccattgcaatcacttctggaggtgctggggctgctggggggagttatcatgatggtgctgattgcccaccttgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutathione S-transferase, C-terminal domain containing - solute carrier family 48 (heme transporter), member 1 - solute carrier family 48 (heme transporter), member 1 - spermidine/spermine N1-acetyltransferase family member 2 |