Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MOBKL1B-MOB1, Mps One Binder kinase activator-like 1B (yeast) Gene
PTXBC003398
New product
Data sheet of MOBKL1B-MOB1, Mps One Binder kinase activator-like 1B (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MOBKL1B-MOB1, Mps One Binder kinase activator-like 1B (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003398 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MOBKL1B |
| Origin species: | Human |
| Product name: | MOBKL1B-MOB1, Mps One Binder kinase activator-like 1B (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC003398 |
| Gene id: | 55233 |
| Gene description: | MOB1, Mps One Binder kinase activator-like 1B (yeast) |
| Synonyms: | MOBKL1B; C2orf6; MATS1; MOB1; MOBK1B; Mob4B; MOB kinase activator 1A; MOB1 Mps One Binder homolog A; MOB1, Mps One Binder kinase activator-like 1B; mob1 alpha; mob1 homolog 1B; mps one binder kinase activator-like 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcttcctcttcagcagccgctcttctaaaacattcaaaccaaagaagaatatccctgaaggatctcatcagtatgaactcttaaaacatgcagaagcaactctaggaagtgggaatctgagacaagctgttatgttgcctgagggagaggatctcaatgaatggattgctgtgaacactgtggatttctttaaccagatcaacatgttatatggaactattacagaattctgcactgaagcaagctgtccagtcatgtctgcaggtccgagatatgaatatcactgggcagatggtactaatattaaaaagccaatcaaatgttctgcaccaaaatacattgactatttgatgacttgggttcaagatcagcttgatgatgaaactctttttccttctaagattggtgtcccatttcccaaaaactttatgtctgtggcaaagactattctaaagcgtctgttcagggtttatgcccatatttatcaccagcactttgattctgtgatgcagctgcaagaggaggcccacctcaacacctcctttaagcactttattttctttgttcaggagtttaatctgattgataggcgtgagctggcacctcttcaagaattaatagagaaacttggatcaaaagacagataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatidylinositol glycan anchor biosynthesis, class X - potassium channel tetramerisation domain containing 13 - phosphatidylinositol glycan anchor biosynthesis, class K - cell division cycle 37 homolog (S. cerevisiae)-like 1 |