Login to display prices
Login to display prices
KCTD13-potassium channel tetramerisation domain containing 13 Gene View larger

KCTD13-potassium channel tetramerisation domain containing 13 Gene

PTXBC036228

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCTD13-potassium channel tetramerisation domain containing 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCTD13-potassium channel tetramerisation domain containing 13 Gene

Proteogenix catalog: PTXBC036228
Ncbi symbol: KCTD13
Product name: KCTD13-potassium channel tetramerisation domain containing 13 Gene
Size: 2ug
Accessions: BC036228
Gene id: 253980
Gene description: potassium channel tetramerisation domain containing 13
Synonyms: BTB/POZ domain-containing protein KCTD13; BACURD1; FKSG86; PDIP1; POLDIP1; hBACURD1; BTB/POZ domain-containing adapter for CUL3-mediated RhoA degradation protein 1; CTD-2574D22.4; TNFAIP1-like protein; polymerase delta-interacting protein 1; potassium channel tetramerisation domain containing 13; potassium channel tetramerization domain containing 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggcggaggcctcgggcccggctgccgccgcggccccgtccctggaagcccccaagccctcgggtctcgagcctggccccgccgcctacggtctcaagccgctgaccccgaacagcaaatacgtgaagctgaacgtgggcggctcgttgcactacaccacgctgcgcaccctcacgggacaggacaccatgctcaaagccatgttcagcggccgcgtggaggtgctgaccgatgccggaggttgggtgctgattgaccggagcggccgtcactttggtacaatcctcaattacctgcgggatgggtctgtgccactgccggagagtacgagagaactgggggagctgctgggcgaagcacgctactacctggtgcagggcctgattgaggactgccagctggcgctgcagcaaaaaagggagacgctgtccccgctgtgcctcatccccatggtgacatctccccgggaggagcagcagctcctggccagcacctccaagcccgtggtgaagctcctgcacaaccgcagtaacaacaagtactcctacaccagcacttcagatgacaacctacttaagaacatcgagctgttcgacaagctggccctgcgcttccacgggcggctactcttcctcaaggatgtcctgggggacgagatctgttgctggtctttctacgggcagggccgcaaaatcgccgaggtgtgctgcacctccattgtctatgctacggagaagaagcagaccaaggtggaatttccagaggcccggatcttcgaggagaccctgaacatcctcatctacgagactccccggggcccagacccagccctcctggaggccacagggggagcagctggagctggtggggctggccgcggggaggatgaagagaaccgagagcaccgtgtccgcaggatccatgtccggcgccatatcacccacgacgagcgtcctcatggccaacaaattgtcttcaaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: