EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene View larger

EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012547
Product type: DNA & cDNA
Ncbi symbol: EIF4A2
Origin species: Human
Product name: EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene
Size: 2ug
Accessions: BC012547
Gene id: 1974
Gene description: eukaryotic translation initiation factor 4A, isoform 2
Synonyms: BM-010; DDX2B; EIF4A; EIF4F; eIF-4A-II; eIF4A-II; eukaryotic initiation factor 4A-II; ATP-dependent RNA helicase eIF4A-2; eukaryotic translation initiation factor 4A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggtggctccgcggattataacagcagagaacatggcggcccagagggaatggaccccgatggtgtcatcgagagcaactggaatgagattgttgataactttgatgatatgaatttaaaggagtctctccttcgtggcatctatgcttacggttttgagaagccttccgctattcagcagagagctattattccctgtattaaagggtatgatgtgattgctcaagctcagtcaggtactggcaagacagccacatttgccatttccatcctgcaacagttggagattgagttcaaggagacccaagcactagtattggcccccaccagagaactggctcaacagatccaaaaggtaattctggcacttggagactatatgggagccacttgtcatgcctgcattggtggaacaaatgttcgaaatgaaatgcaaaaactgcaggctgaagcaccacatattgttgttggtacacccgggagagtgtttgatatgttaaacagaagatacctttctccaaaatggatcaaaatgtttgttttggatgaagcagatgaaatgttgagccgtggttttaaggatcaaatctatgagattttccaaaaactaaacacaagtattcaggttgtgttgctttctgccacaatgccaactgatgtgttggaagtgaccaaaaaattcatgagagatccaattcgaattctggtgaaaaaggaagaattgacccttgaaggaatcaaacagttttatattaatgttgagagagaggaatggaagttggatacactttgtgacttgtacgagacactgaccattacacaggctgttatttttctcaatacgaggcgcaaggtggactggctgactgagaagatgcatgccagagacttcacagtttctgctctgcatggtgacatggaccagaaggagagagatgttatcatgagggaattccggtcagggtcaagtcgtgttctgatcactactgacttgttggctcgcgggattgatgtgcaacaagtgtctttggttataaattatgatctacctaccaatcgtgaaaactatattcacagaattggcagagggggtcgatttgggaggaaaggtgtggctataaactttgttactgaagaagacaagaggattcttcgtgacattgagactttctacaatactacagtggaggagatgcccatgaatgtggctgaccttatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 30 (zinc transporter), member 4
- phosphatidylinositol glycan anchor biosynthesis, class O
- solute carrier family 39 (zinc transporter), member 7
- glutathione S-transferase, C-terminal domain containing

Buy EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene now

Add to cart