Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene
PTXBC015810
New product
Data sheet of MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015810 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAP1LC3A |
| Origin species: | Human |
| Product name: | MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene |
| Size: | 2ug |
| Accessions: | BC015810 |
| Gene id: | 84557 |
| Gene description: | microtubule-associated protein 1 light chain 3 alpha |
| Synonyms: | ATG8E; LC3A; MAP1ALC3; MAP1BLC3; microtubule-associated proteins 1A/1B light chain 3A; MAP1 light chain 3-like protein 1; MAP1A/1B light chain 3 A; MAP1A/MAP1B LC3 A; MAP1A/MAP1B light chain 3 A; autophagy-related ubiquitin-like modifier LC3 A; microtubule-associated proteins 1A/1B light chain 3; microtubule associated protein 1 light chain 3 alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccctcagaccggcctttcaagcagcggcggagcttcgccgaccgctgtaaggaggtacagcagatccgcgaccagcaccccagcaaaatcccggtgatcatcgagcgctacaagggtgagaagcagctgcccgtcctggacaagaccaagtttttggtcccggaccatgtcaacatgagcgagttggtcaagatcatccggcgccgcctgcagctgaaccccacgcaggccttcttcctgctggtgaaccagcacagcatggtgagtgtgtccacgcccatcgcggacatctacgagcaggagaaagacgaggacggcttcctctatatggtctacgcctcccaggaaaccttcggcttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP-binding cassette, sub-family C (CFTR/MRP), member 9 - tumor necrosis factor (ligand) superfamily, member 14 - MOB1, Mps One Binder kinase activator-like 1B (yeast) - phosphatidylinositol glycan anchor biosynthesis, class X |