MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene View larger

MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015810
Product type: DNA & cDNA
Ncbi symbol: MAP1LC3A
Origin species: Human
Product name: MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene
Size: 2ug
Accessions: BC015810
Gene id: 84557
Gene description: microtubule-associated protein 1 light chain 3 alpha
Synonyms: ATG8E; LC3A; MAP1ALC3; MAP1BLC3; microtubule-associated proteins 1A/1B light chain 3A; MAP1 light chain 3-like protein 1; MAP1A/1B light chain 3 A; MAP1A/MAP1B LC3 A; MAP1A/MAP1B light chain 3 A; autophagy-related ubiquitin-like modifier LC3 A; microtubule-associated proteins 1A/1B light chain 3; microtubule associated protein 1 light chain 3 alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccctcagaccggcctttcaagcagcggcggagcttcgccgaccgctgtaaggaggtacagcagatccgcgaccagcaccccagcaaaatcccggtgatcatcgagcgctacaagggtgagaagcagctgcccgtcctggacaagaccaagtttttggtcccggaccatgtcaacatgagcgagttggtcaagatcatccggcgccgcctgcagctgaaccccacgcaggccttcttcctgctggtgaaccagcacagcatggtgagtgtgtccacgcccatcgcggacatctacgagcaggagaaagacgaggacggcttcctctatatggtctacgcctcccaggaaaccttcggcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP-binding cassette, sub-family C (CFTR/MRP), member 9
- tumor necrosis factor (ligand) superfamily, member 14
- MOB1, Mps One Binder kinase activator-like 1B (yeast)
- phosphatidylinositol glycan anchor biosynthesis, class X

Buy MAP1LC3A-microtubule-associated protein 1 light chain 3 alpha Gene now

Add to cart