VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene View larger

VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023286
Product type: DNA & cDNA
Ncbi symbol: VAMP1
Origin species: Human
Product name: VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene
Size: 2ug
Accessions: BC023286
Gene id: 6843
Gene description: vesicle-associated membrane protein 1 (synaptobrevin 1)
Synonyms: SPAX1; SYB1; VAMP-1; vesicle-associated membrane protein 1; vesicle-associated membrane protein 1 (synaptobrevin 1); vesicle associated membrane protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgctccagctcagccacctgctgaagggacagaagggactgccccaggtgggggtccccctggccctcctcctaacatgaccagtaacagacgactacagcaaacccaggcacaagtggaggaggtggtggacatcatacgtgtgaacgtggacaaggtcctggagagggaccagaagctgtcagagctggatgaccgagctgatgccttgcaggcaggagcatcacaatttgagagcagtgctgcaaagctaaagaggaagtattggtggaaaaactgcaagatgatgatcatgctgggagccatctgtgccatcatcgtggtagttattgtaagtaagtatcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - microtubule-associated protein 1 light chain 3 alpha
- ATP-binding cassette, sub-family C (CFTR/MRP), member 9
- tumor necrosis factor (ligand) superfamily, member 14
- MOB1, Mps One Binder kinase activator-like 1B (yeast)

Buy VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene now

Add to cart