PIGP-phosphatidylinositol glycan anchor biosynthesis, class P Gene View larger

PIGP-phosphatidylinositol glycan anchor biosynthesis, class P Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIGP-phosphatidylinositol glycan anchor biosynthesis, class P Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PIGP-phosphatidylinositol glycan anchor biosynthesis, class P Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005180
Product type: DNA & cDNA
Ncbi symbol: PIGP
Origin species: Human
Product name: PIGP-phosphatidylinositol glycan anchor biosynthesis, class P Gene
Size: 2ug
Accessions: BC005180
Gene id: 51227
Gene description: phosphatidylinositol glycan anchor biosynthesis, class P
Synonyms: DCRC; DCRC-S; DSRC; PIG-P; phosphatidylinositol N-acetylglucosaminyltransferase subunit P; Down syndrome critical region gene 5; Down syndrome critical region protein 5; Down syndrome critical region protein C; phosphatidylinositol glycan, class P; phosphatidylinositol-glycan biosynthesis class P protein; phosphatidylinositol-n-acetylglucosaminyltranferase subunit; phosphatidylinositol glycan anchor biosynthesis class P
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggaaaattcaccgtcgccattgccagaaagagcgatttatggctttgttcttttcttaagctcccaatttggcttcatactttacctcgtgtgggcctttattcctgaatcttggctaaactctttaggtttaacctattggcctcaaaaatattgggcagttgcattacctgtctacctccttattgctatagtaattggctacgtgctcttgtttgggattaacatgatgagtacctctccactcgactccatccatacaatcacagataactatgcaaaaaatcaacagcagaagaaataccaagaggaggccattccagccttaagagatatttctattagtgaagtaaaccaaatgttctttcttgcagccaaagaactttacaccaaaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - general transcription factor IIF, polypeptide 2, 30kDa
- proteasome (prosome, macropain) subunit, beta type, 10
- transmembrane and tetratricopeptide repeat containing 4
- eukaryotic translation initiation factor 4A, isoform 2

Buy PIGP-phosphatidylinositol glycan anchor biosynthesis, class P Gene now

Add to cart