PIGC-phosphatidylinositol glycan anchor biosynthesis, class C Gene View larger

PIGC-phosphatidylinositol glycan anchor biosynthesis, class C Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIGC-phosphatidylinositol glycan anchor biosynthesis, class C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PIGC-phosphatidylinositol glycan anchor biosynthesis, class C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006539
Product type: DNA & cDNA
Ncbi symbol: PIGC
Origin species: Human
Product name: PIGC-phosphatidylinositol glycan anchor biosynthesis, class C Gene
Size: 2ug
Accessions: BC006539
Gene id: 5279
Gene description: phosphatidylinositol glycan anchor biosynthesis, class C
Synonyms: GPI2; phosphatidylinositol N-acetylglucosaminyltransferase subunit C; PIG-C; phosphatidylinositol-glycan biosynthesis, class C protein; phosphatidylinositol glycan anchor biosynthesis class C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtatgctcaacctgtgactaacaccaaggaggtcaagtggcagaaggtcttgtatgagcgacagccctttcctgataactatgtggaccggcgattcctggaagagctccggaaaaacatccatgctcggaaataccaatattgggctgtggtatttgagtccagtgtggtgatccagcagctgtgcagtgtttgtgtttttgtggttatctggtggtatatggatgagggtcttctggccccccattggcttttagggactggtctggcttcttcactgattgggtatgttttgtttgatctcattgatggaggtgaagggcggaagaagagtgggcagacccggtgggctgacctgaagagtgccctagtcttcattactttcacttatgggttttcaccagtgctgaagacccttacagagtctgtcagcactgacaccatctatgccatgtcagtcttcatgctgttaggccatctcatcttttttgactatggtgccaatgctgccattgtatccagcacactatccttgaacatggccatctttgcttctgtatgcttggcatcacgtcttccccggtccctgcatgccttcatcatggtgacatttgccattcagatttttgccctgtggcccatgttgcagaagaaactaaaggcatgtactccccggagctatgtgggggtcacactgctttttgcattttcagccgtgggaggcctactgtccattagtgctgtgggagccgtactctttgcccttctgctgatgtctatctcatgtctgtgtccattctacctcattcgcttgcagctttttaaagaaaacattcatgggccttgggatgaagctgaaatcaaggaagacttgtccaggttcctcagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium channel tetramerisation domain containing 17
- twinfilin, actin-binding protein, homolog 2 (Drosophila)
- twinfilin, actin-binding protein, homolog 2 (Drosophila)
- eukaryotic translation initiation factor 4A, isoform 3

Buy PIGC-phosphatidylinositol glycan anchor biosynthesis, class C Gene now

Add to cart