Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FAM19A3-family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 Gene
PTXBC112268
New product
Data sheet of FAM19A3-family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM19A3-family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC112268 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM19A3 |
| Origin species: | Human |
| Product name: | FAM19A3-family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 Gene |
| Size: | 2ug |
| Accessions: | BC112268 |
| Gene id: | 284467 |
| Gene description: | family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 |
| Synonyms: | protein FAM19A3; TAFA-3; TAFA3; chemokine-like protein TAFA-3; family with sequence similarity 19 (chemokine (C-C motif)-like), member A3; family with sequence similarity 19 member A3, C-C motif chemokine like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgagagggtcgagcggaactggagcacgggcggctggctgctggcactgtgcctggcctggctgtggacccacctgaccttggctgccttgcagcctcccactgccacagtgcttgtgcagcagggcacctgcgaggtgattgcggctcaccgctgctgcaaccggaaccgcatcgaggagcgctcccagacggtgaaatgctcctgtttttctggccaggtggccggcaccacgcgggcaaagccctcctgcgtggacgacctgctcttggctgcccactgtgctcgtagagaccctagagctgcactccgcctcctgctcccacagcctccatcgtcctgcagagatggtggtgtcagatggagccctgcctgccgggggaggagtgtaaggtgctcccggacctgtcgggatggagctgcagcagtggacacaaagtcaaaaccaccaaggtcacacgatagctcttgggggtcacggcctggacaagaaaggcttgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serine palmitoyltransferase, long chain base subunit 1 - unconventional SNARE in the ER 1 homolog (S. cerevisiae) - NK2 transcription factor related, locus 5 (Drosophila) - general transcription factor IIH, polypeptide 2, 44kDa |