ABHD3-abhydrolase domain containing 3 Gene View larger

ABHD3-abhydrolase domain containing 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABHD3-abhydrolase domain containing 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ABHD3-abhydrolase domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021196
Product type: DNA & cDNA
Ncbi symbol: ABHD3
Origin species: Human
Product name: ABHD3-abhydrolase domain containing 3 Gene
Size: 2ug
Accessions: BC021196
Gene id: 171586
Gene description: abhydrolase domain containing 3
Synonyms: phospholipase ABHD3; LABH3; abhydrolase domain-containing protein 3; alpha/beta hydrolase domain containing protein 3; lung alpha/beta hydrolase 3; abhydrolase domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtgcctggccatggacctgcggatgttgtcccgggagctctccctctacctggaacaccaagtccgggtggggttcttcggctcgggggtgggcttatcccttatcctgggcttcagcgtcgcttatgccttctactacctgagcagcattgccaagaaaccccagttagtgaccgggggtgagagtttcagccgcttccttcaagaccactgtcccgtggttacagaaacgtactacccgacggtctggtgctgggagggtcgaggacagaccctgcttagacctttcatcacttcgaagcccccggtgcagtacaggaatgaacttattaaaactgcagatggaggacagatttcactggactggtttgataatgataacagtacgtgttatatggatgccagcaccagacctactatcttattgttgcctggcctcacgggaacaagcaaggagtcatatatccttcatatgatccatcttagtgaagaattaggatacagatgtgtggtttttaacaacagaggagtggcgggggagaatctcttgacgccaaggacttattgttgtgctaacactgaagacttggagacagttattcaccatgtacacagcctgtacccttctgctcctttcctggcagcaggggtttcaatgggaggaatgctgcttctaaattacttgggcaaaattgggtccaaaacgcctttgatggcagctgcaactttttccgttggttggaacaccttcgcttgctcagagtcattggaaaaaccactgaactggctactttttaattactatttgacaacctgccttcagtcttcagttaataagcaccgacatatgtttgtaaaacaagttgatatggatcatgtcatgaaggctaaatccatcagagagtttgataagcgattcacttcagtcatgtttggataccaaacaattgatgattattatactgatgccagtccgagtcctagactgaagtcagtaggaattccagtattgtgtctaaattctgtggatgatgttttctcacccagtcatgctattccaatagaaactgctaagcaaaatcctaatgttgctttggtccttacttcttatggaggccatattggttttctggagggaatctggccaagacagtccacttacatggatcgtgtcttcaagcaatttgtgcaagccatggttgagcatggacatgaactctcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 11 receptor, alpha
- plasminogen activator, urokinase
- inositol hexaphosphate kinase 1
- tripartite motif-containing 43

Buy ABHD3-abhydrolase domain containing 3 Gene now

Add to cart