IL11RA-interleukin 11 receptor, alpha Gene View larger

IL11RA-interleukin 11 receptor, alpha Gene

PTXBC003110

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL11RA-interleukin 11 receptor, alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IL11RA-interleukin 11 receptor, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003110
Product type: DNA & cDNA
Ncbi symbol: IL11RA
Origin species: Human
Product name: IL11RA-interleukin 11 receptor, alpha Gene
Size: 2ug
Accessions: BC003110
Gene id: 3590
Gene description: interleukin 11 receptor, alpha
Synonyms: CRSDA; interleukin-11 receptor subunit alpha; IL-11 receptor subunit alpha; IL-11R subunit alpha; interleukin 11 receptor, alpha; interleukin-11 receptor alpha chain; interleukin 11 receptor subunit alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcagcagctgctcagggctgagcagggtcctggtggccgtggctacagccctggtgtctgcctcctccccctgcccccaggcctggggccccccaggggtccagtatgggcagccaggcaggtccgtgaagctgtgttgtcctggagtgactgccggggacccagtgtcctggtttcgggatggggagccaaagctgctccagggacctgactctgggctagggcatgaactggtcctggcccaggcagacagcactgatgagggcacctacatctgccagaccctggatggtgcacttgggggcacagtgaccctgcagctgggctaccctccagcccgccctgttgtctcctgccaagcagccgactatgagaacttctcttgcacttggagtcccagccagatcagcggtttacccacccgctacctcacctcctacaggaagaagacagtcctaggagctgatagccagaggaggagtccatccacagggccctggccatgcccacaggatcccctaggggctgcccgctgtgttgtccacggggctgagttctggagccagtaccggattaatgtgactgaggtgaacccactgggtgccagcacacgcctgctggatgtgagcttgcagagcatcttgcgccctgacccaccccagggcctgcgggtagagtcagtaccaggttacccccgacgcctgcgagccagctggacataccctgcctcctggccgtgccagccccacttcctgctcaagttccgtttgcagtaccgtccggcgcagcatccagcctggtccacggtggagccagctggactggaggaggtgatcacagatgctgtggctgggctgccccatgctgtacgagtcagtgcccgggactttctagatgctggcacctggagcacctggagcccggaggcctggggaactccgagcactgggaccataccaaaggagataccagcatggggccagctacacacgcagccagaggtggagcctcaggtggacagccctgctcctccaaggccctccctccaaccacaccctcggctacttgatcacagggactctgtggagcaggtagctgtgctggcgtctttgggaatcctttctttcctgggactggtggctggggccctggcactggggctctggctgaggctgagacggggtgggaaggatggatccccaaagcctgggttcttggcctcagtgattccagtggacaggcgtccaggagctccaaacctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - plasminogen activator, urokinase
- inositol hexaphosphate kinase 1
- tripartite motif-containing 43
- molybdenum cofactor synthesis 3

Buy IL11RA-interleukin 11 receptor, alpha Gene now

Add to cart