Login to display prices
Login to display prices
MOCS3-molybdenum cofactor synthesis 3 Gene View larger

MOCS3-molybdenum cofactor synthesis 3 Gene

PTXBC015939

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MOCS3-molybdenum cofactor synthesis 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MOCS3-molybdenum cofactor synthesis 3 Gene

Proteogenix catalog: PTXBC015939
Ncbi symbol: MOCS3
Product name: MOCS3-molybdenum cofactor synthesis 3 Gene
Size: 2ug
Accessions: BC015939
Gene id: 27304
Gene description: molybdenum cofactor synthesis 3
Synonyms: adenylyltransferase and sulfurtransferase MOCS3; UBA4; MPT synthase sulfurylase; UBA4, ubiquitin-activating enzyme E1 homolog; molybdenum cofactor synthesis protein 3; molybdopterin synthase sulfurylase; ubiquitin-like modifier activating enzyme 4; molybdenum cofactor synthesis 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcccgggaggaggtactcgccttacaagctgaagttgcccaacgtgaggaggaattgaattcgctgaagcagaagctggcgtcggctcttttggctgagcaggaaccgcagccagaacggctggttccggtgtcgccgctgccgccgaaggccgctctgtcccgagatgagattctgcgctatagccggcagctagtgctgcccgagctgggcgtgcacggacagctgcgcctggggaccgcgtgcgtgctaatcgtgggctgcggtggactcggctgtccactagcgcagtacttggcagcggccggcgtgggccgccttggccttgtggactatgacgtggtagagatgagcaacctggcccgccaagtgctgcatggcgaggcactggctggccaggccaaggccttttcggccgccgcctcgctgcgccgcctcaattcggcagtggaatgcgtgccgtacactcaggcccttacgccagccactgccctagacctggtccgccgatatgatgtggtggctgactgctcggacaacgtgcccactcgctacctggttaatgacgcatgtgtgctggcgggtcggcccctcgtgtctgccagtgccttgcgcttcgagggccaaatcacagtctaccattatgacggtggcccttgctatcgctgcatattcccccaaccacccccagcggagacagtgaccaactgcgcggacggcggggtgctcggtgtcgttaccggggtcctgggctgcctgcaggccttggaagtgctgaaaatcgctgcgggtctgggcccctcttacagtggcagcttgttgctctttgatgccctgagagggcatttccgctctattcggctgcggagccgcaggctcgactgtgcagcttgcggggaacggcccactgtgactgatctgctggactatgaagccttctgtggctcctcagccactgataaatgccgctccctgcaactactgagcccagaggagcgtgtttctgtcaccgactataagcgactgctggattctggggcattccacctgttgctggacgtcaggcctcaggtggaggtggacatttgtcgtttgcctcatgccctacacatccctctgaaacatttggaacgcagggatgcggagagcctgaaactcttaaaagaagcaatctgggaagagaagcagggcacacaagaaggggctgctgtccccatttatgtgatttgcaaactgggaaatgactcacagaaagccgtgaagatcctccagtccttatcagcagctcaagagttagaccctttaacagttcgggatgttgtggggggcctcatggcctgggctgccaaaatcgatggaacatttccacagtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: