MOCS3-molybdenum cofactor synthesis 3 Gene View larger

MOCS3-molybdenum cofactor synthesis 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MOCS3-molybdenum cofactor synthesis 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MOCS3-molybdenum cofactor synthesis 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015939
Product type: DNA & cDNA
Ncbi symbol: MOCS3
Origin species: Human
Product name: MOCS3-molybdenum cofactor synthesis 3 Gene
Size: 2ug
Accessions: BC015939
Gene id: 27304
Gene description: molybdenum cofactor synthesis 3
Synonyms: adenylyltransferase and sulfurtransferase MOCS3; UBA4; MPT synthase sulfurylase; UBA4, ubiquitin-activating enzyme E1 homolog; molybdenum cofactor synthesis protein 3; molybdopterin synthase sulfurylase; ubiquitin-like modifier activating enzyme 4; molybdenum cofactor synthesis 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcccgggaggaggtactcgccttacaagctgaagttgcccaacgtgaggaggaattgaattcgctgaagcagaagctggcgtcggctcttttggctgagcaggaaccgcagccagaacggctggttccggtgtcgccgctgccgccgaaggccgctctgtcccgagatgagattctgcgctatagccggcagctagtgctgcccgagctgggcgtgcacggacagctgcgcctggggaccgcgtgcgtgctaatcgtgggctgcggtggactcggctgtccactagcgcagtacttggcagcggccggcgtgggccgccttggccttgtggactatgacgtggtagagatgagcaacctggcccgccaagtgctgcatggcgaggcactggctggccaggccaaggccttttcggccgccgcctcgctgcgccgcctcaattcggcagtggaatgcgtgccgtacactcaggcccttacgccagccactgccctagacctggtccgccgatatgatgtggtggctgactgctcggacaacgtgcccactcgctacctggttaatgacgcatgtgtgctggcgggtcggcccctcgtgtctgccagtgccttgcgcttcgagggccaaatcacagtctaccattatgacggtggcccttgctatcgctgcatattcccccaaccacccccagcggagacagtgaccaactgcgcggacggcggggtgctcggtgtcgttaccggggtcctgggctgcctgcaggccttggaagtgctgaaaatcgctgcgggtctgggcccctcttacagtggcagcttgttgctctttgatgccctgagagggcatttccgctctattcggctgcggagccgcaggctcgactgtgcagcttgcggggaacggcccactgtgactgatctgctggactatgaagccttctgtggctcctcagccactgataaatgccgctccctgcaactactgagcccagaggagcgtgtttctgtcaccgactataagcgactgctggattctggggcattccacctgttgctggacgtcaggcctcaggtggaggtggacatttgtcgtttgcctcatgccctacacatccctctgaaacatttggaacgcagggatgcggagagcctgaaactcttaaaagaagcaatctgggaagagaagcagggcacacaagaaggggctgctgtccccatttatgtgatttgcaaactgggaaatgactcacagaaagccgtgaagatcctccagtccttatcagcagctcaagagttagaccctttaacagttcgggatgttgtggggggcctcatggcctgggctgccaaaatcgatggaacatttccacagtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tripartite motif-containing 21
- tripartite motif-containing 39
- signal-regulatory protein alpha
- spinster homolog 1 (Drosophila)

Buy MOCS3-molybdenum cofactor synthesis 3 Gene now

Add to cart