SIRPA-signal-regulatory protein alpha Gene View larger

SIRPA-signal-regulatory protein alpha Gene

PTXBC026692

New product

Data sheet of SIRPA-signal-regulatory protein alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SIRPA-signal-regulatory protein alpha Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC026692
Product type: DNA & cDNA
Ncbi symbol: SIRPA
Origin species: Human
Product name: SIRPA-signal-regulatory protein alpha Gene
Size: 2ug
Accessions: BC026692
Gene id: 140885
Gene description: signal-regulatory protein alpha
Synonyms: BIT; CD172A; MFR; MYD-1; P84; PTPNS1; SHPS1; SIRP; tyrosine-protein phosphatase non-receptor type substrate 1; CD172 antigen-like family member A; brain-immunoglobulin-like molecule with tyrosine-based activation motifs; inhibitory receptor SHPS-1; macrophage fusion receptor; myd-1 antigen; tyrosine phosphatase SHP substrate 1; signal regulatory protein alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcccgccggcccggcccccggccgcctcgggccgctgctctgcctgctgctcgccgcgtcctgcgcctggtcaggagtggcgggtgaggaggagctgcaggtgattcagcctgacaagtccgtatcagttgcagctggagagtcggccattctgcactgcactgtgacctccctgatccctgtggggcccatccagtggttcagaggagctggaccagcccgggaattaatctacaatcaaaaagaaggccacttcccccgggtaacaactgtttcagagtccacaaagagagaaaacatggacttttccatcagcatcagtaacatcaccccagcagatgccggcacctactactgtgtgaagttccggaaagggagccctgacacggagtttaagtctggagcaggcactgagctgtctgtgcgtgccaaaccctctgcccccgtggtatcgggccctgcggcgagggccacacctcagcacacagtgagcttcacctgcgagtcccacggcttctcacccagagacatcaccctgaaatggttcaaaaatgggaatgagctctcagacttccagaccaacgtggaccccgtaggagagagcgtgtcctacagcatccacagcacagccaaggtggtgctgacccgcgaggacgttcactctcaagtcatctgcgaggtggcccacgtcaccttgcagggggaccctcttcgtgggactgccaacttgtctgagaccatccgagttccacccaccttggaggttactcaacagcccgtgagggcagagaaccaggtgaatgtcacctgccaggtgaggaagttctacccccagagactacagctgacctggttggagaatggaaacgtgtcccggacagaaacggcctcaaccgttacagagaacaaggatggtacctacaactggatgagctggctcctggtgaatgtatctgcccacagggatgatgtgaagctcacctgccaggtggagcatgacgggcagccagcggtcagcaaaagccatgacctgaaggtctcagcccacccgaaggagcagggctcaaataccgccgctgagaacactggatctaatgaacggaacatctatattgtggtgggtgtggtgtgcaccttgctggtggccctactgatggcggccctctacctcgtccgaatcagacagaagaaagcccagggctccacttcttctacaaggttgcatgagcccgagaagaatgccagagaaataacacaggtacagtccttggacacaaatgatatcacatatgcagacctgaacctgcccaaggggaagaagcctgctccccaggctgcggagcccaacaaccacacggagtatgccagcattcagaccagcccgcagcccgcgtcggaggacaccctcacctatgctgacctggacatggtccacctcaaccggacccccaagcagccggcccccaagcctgagccgtccttctcagagtacgccagcgtccaggtcccgaggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spinster homolog 1 (Drosophila)
- aarF domain containing kinase 4
- calpain 1, (mu/I) large subunit
- denticleless homolog (Drosophila)

Buy SIRPA-signal-regulatory protein alpha Gene now

Add to cart