ORAI1-ORAI calcium release-activated calcium modulator 1 Gene View larger

ORAI1-ORAI calcium release-activated calcium modulator 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ORAI1-ORAI calcium release-activated calcium modulator 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ORAI1-ORAI calcium release-activated calcium modulator 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015369
Product type: DNA & cDNA
Ncbi symbol: ORAI1
Origin species: Human
Product name: ORAI1-ORAI calcium release-activated calcium modulator 1 Gene
Size: 2ug
Accessions: BC015369
Gene id: 84876
Gene description: ORAI calcium release-activated calcium modulator 1
Synonyms: CRACM1; IMD9; ORAT1; TAM2; TMEM142A; calcium release-activated calcium channel protein 1; calcium release-activated calcium modulator 1; protein orai-1; transmembrane protein 142A; ORAI calcium release-activated calcium modulator 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcctcaacgagcactccatgcaggcgctgtcctggcgcaagctctacttgagccgcgccaagcttaaagcctccagccggacctcggctctgctctccggcttcgccatggtggcaatggtggaggtgcagctggacgctgaccacgactacccaccggggctgctcatcgccttcagtgcctgcaccacagtgctggtggctgtgcacctgtttgcgctcatgatcagcacctgcatcctgcccaacatcgaggcggtgagcaacgtgcacaatctcaactcggtcaaggagtccccccatgagcgcatgcaccgccacatcgagctggcctgggccttctccaccgtcattggcacgctgctcttcctagctgaggtggtgctgctctgctgggtcaagttcttgcccctcaagaagcagccaggccagccaaggcccaccagcaagccccccgccagtggcgcagcagccaacgtcagcaccagcggcatcaccccgggccaggcagctgccatcgcctcgaccaccatcatggtgcccttcggcctgatctttatcgtcttcgccgtccacttctaccgctcactggttagccataagaccgaccgacagttccaggagctcaacgagctggcggagtttgcccgcttacaggaccagctggaccacagaggggaccaccccctgacgcccggcagccactatgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial translational release factor 1-like
- GTP binding protein overexpressed in skeletal muscle
- activating signal cointegrator 1 complex subunit 1
- ubiquitin-like 7 (bone marrow stromal cell-derived)

Buy ORAI1-ORAI calcium release-activated calcium modulator 1 Gene now

Add to cart