Login to display prices
Login to display prices
C10orf111-chromosome 10 open reading frame 111 Gene View larger

C10orf111-chromosome 10 open reading frame 111 Gene

PTXBC029034

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf111-chromosome 10 open reading frame 111 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf111-chromosome 10 open reading frame 111 Gene

Proteogenix catalog: PTXBC029034
Ncbi symbol: C10orf111
Product name: C10orf111-chromosome 10 open reading frame 111 Gene
Size: 2ug
Accessions: BC029034
Gene id: 221060
Gene description: chromosome 10 open reading frame 111
Synonyms: uncharacterized protein C10orf111; bA455B2.4; chromosome 10 open reading frame 111
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatccctgcagactccccagcaccgcgaaaatcaagataaaagggagaaggagtatggggtaaaacacatgcctatgggcaataatgcagggaatcttgagcccgaaaagagaaaggcagtaagagttgccttgagttcagcaacagctgcacagaatatcccgtccagtgtccactgtggctgctccaagcaatggagactcaggctaccatcggagtcgctgcaaagtcggggacaagtgatgaagcggccgaataacattttaaagctcaggaatctggatctgttgatctacccttggccagaacttagaagacggcaggttgcttctgacctaatgagcctcctccttctccccgctttttccggccttacttgggcccccttccttttcctctttacgtatctgcctccttttctcaatctcctcactgttggttttgtatcctattttctggtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice