C10orf111-chromosome 10 open reading frame 111 Gene View larger

C10orf111-chromosome 10 open reading frame 111 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf111-chromosome 10 open reading frame 111 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf111-chromosome 10 open reading frame 111 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029034
Product type: DNA & cDNA
Ncbi symbol: C10orf111
Origin species: Human
Product name: C10orf111-chromosome 10 open reading frame 111 Gene
Size: 2ug
Accessions: BC029034
Gene id: 221060
Gene description: chromosome 10 open reading frame 111
Synonyms: uncharacterized protein C10orf111; bA455B2.4; chromosome 10 open reading frame 111
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatccctgcagactccccagcaccgcgaaaatcaagataaaagggagaaggagtatggggtaaaacacatgcctatgggcaataatgcagggaatcttgagcccgaaaagagaaaggcagtaagagttgccttgagttcagcaacagctgcacagaatatcccgtccagtgtccactgtggctgctccaagcaatggagactcaggctaccatcggagtcgctgcaaagtcggggacaagtgatgaagcggccgaataacattttaaagctcaggaatctggatctgttgatctacccttggccagaacttagaagacggcaggttgcttctgacctaatgagcctcctccttctccccgctttttccggccttacttgggcccccttccttttcctctttacgtatctgcctccttttctcaatctcctcactgttggttttgtatcctattttctggtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - similar to common salivary protein 1
- trafficking protein particle complex 3
- guanylate cyclase activator 1A (retina)
- immunoglobulin lambda-like polypeptide 1

Buy C10orf111-chromosome 10 open reading frame 111 Gene now

Add to cart