LOC124220-similar to common salivary protein 1 Gene View larger

LOC124220-similar to common salivary protein 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC124220-similar to common salivary protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LOC124220-similar to common salivary protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009722
Product type: DNA & cDNA
Ncbi symbol: LOC124220
Origin species: Human
Product name: LOC124220-similar to common salivary protein 1 Gene
Size: 2ug
Accessions: BC009722
Gene id: 124220
Gene description: similar to common salivary protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctgctgctcacgcttgccctcctggggggccccacctgggcagggaagatgtatggccctggaggaggcaagtatttcagcaccactgaagactacgaccatgaaatcacagggctgcgggtgtctgtaggtcttctcctggtgaaaagtgtccaggtgaaacttggagactcctgggacgtgaaactgggagccttaggtgggaatacccaggaagtcaccctgcagccaggcgaatacatcacaaaagtctttgtcgccttccaagctttcctccggggtatggtcatgtacaccagcaaggaccgctatttctattttgggaagcttgatggccagatctcctctgcctaccccagccaagaggggcaggtgctggtgggcatctatggccagtatcaactccttggcatcaagagcattggctttgaatggaattatccactagaggagccgaccactgagccaccagttaatctcacatactcagcaaactcacccgtgggtcgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - trafficking protein particle complex 3
- guanylate cyclase activator 1A (retina)
- immunoglobulin lambda-like polypeptide 1
- lysosomal protein transmembrane 4 beta

Buy LOC124220-similar to common salivary protein 1 Gene now

Add to cart