Login to display prices
Login to display prices
LOC124220-similar to common salivary protein 1 Gene View larger

LOC124220-similar to common salivary protein 1 Gene

PTXBC009722

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC124220-similar to common salivary protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC124220-similar to common salivary protein 1 Gene

Proteogenix catalog: PTXBC009722
Ncbi symbol: LOC124220
Product name: LOC124220-similar to common salivary protein 1 Gene
Size: 2ug
Accessions: BC009722
Gene id: 124220
Gene description: similar to common salivary protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctgctgctcacgcttgccctcctggggggccccacctgggcagggaagatgtatggccctggaggaggcaagtatttcagcaccactgaagactacgaccatgaaatcacagggctgcgggtgtctgtaggtcttctcctggtgaaaagtgtccaggtgaaacttggagactcctgggacgtgaaactgggagccttaggtgggaatacccaggaagtcaccctgcagccaggcgaatacatcacaaaagtctttgtcgccttccaagctttcctccggggtatggtcatgtacaccagcaaggaccgctatttctattttgggaagcttgatggccagatctcctctgcctaccccagccaagaggggcaggtgctggtgggcatctatggccagtatcaactccttggcatcaagagcattggctttgaatggaattatccactagaggagccgaccactgagccaccagttaatctcacatactcagcaaactcacccgtgggtcgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice