Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ALG5-asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) Gene
PTXBC012531
New product
Data sheet of ALG5-asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALG5-asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012531 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALG5 |
| Origin species: | Human |
| Product name: | ALG5-asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC012531 |
| Gene id: | 29880 |
| Gene description: | asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) |
| Synonyms: | ALG5, dolichyl-phosphate beta-glucosyltransferase; Alg5, S. cerevisiae, homolog of; bA421P11.2; dolichyl-phosphate beta-glucosyltransferase; asparagine-linked glycosylation 5 homolog (S. cerevisiae, dolichyl-phosphate beta-glucosyltransferase); asparagine-linked glycosylation 5 homolog (yeast, dolichyl-phosphate beta-glucosyltransferase); asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog; asparagine-linked glycosylation protein 5 homolog; dolP-glucosyltransferase; dolichyl phosphate glucosyltransferase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctccgcttctgttgcagctggcggtgctcggcgcggcgctggcggccgcagccctcgtactgatttccatcgttgcatttacaactgctacaaaaatgccagcactccatcgacatgaagaagagaaattcttcttaaatgccaaaggccagaaagaaactttacccagcatatgggactcacctaccaaacaactttctgtcgttgtgccttcatacaatgaagaaaaacggttgcctgtgatgatggatgaagctctgagctatctagagaagagacagaaacgagatcctgcgttcacttatgaagtgatagtagttgatgatggcagtaaagatcagacctcaaaggtagcttttaaatattgccagaaatatggaagtgacaaagtacgtgtgataaccctggtgaagaatcgtggaaaaggtggagcgattagaatgggtatattcagttctcgaggagaaaagatccttatggcagatgctgatggagccacaaagtttccagatgttgagaaattagaaaaggggctaaatgatctacagccttggcctaatcaaatggctatagcatgtggatctcgagctcatttagaaaaagaatcaattgctcagcgttcttacttccgtactcttctcatgtatgggttccactttctggtgtggttcctttgtgtcaaaggaatcagggacacacagtgtgggttcaaattatttactcgagaagcagcttcacggacgttttcatctctacacgttgaacgatgggcatttgatgtagaactactgtacatagcacagttctttaaaattccaatagcagaaattgctgtcaactggacagaaattgaaggttctaaattagttccattctggagctggctacaaatgggtaaagacctactttttatacgacttcgatatttgactggtgcctggaggcttgagcaaactcggaaaatgaattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase - integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide) - phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase |