PISD-phosphatidylserine decarboxylase Gene View larger

PISD-phosphatidylserine decarboxylase Gene

PTXBC001482

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PISD-phosphatidylserine decarboxylase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PISD-phosphatidylserine decarboxylase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001482
Product type: DNA & cDNA
Ncbi symbol: PISD
Origin species: Human
Product name: PISD-phosphatidylserine decarboxylase Gene
Size: 2ug
Accessions: BC001482
Gene id: 23761
Gene description: phosphatidylserine decarboxylase
Synonyms: DJ858B16; PSD; PSDC; PSSC; dJ858B16.2; phosphatidylserine decarboxylase proenzyme, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgtgtcagtcagaggcgcggcaaggaccagagctccgcgcggcgaaatggttgcacttcccccagctggccctgaggcggaggctggggcagctgagctgcatgtccagacccgctctgaaactgcgctcctggcccttgaccgtcctctactacctcctgcccttcggcgccctcagaccgctcagccgggtgggatggaggcccgtaagcagggtggctttgtacaagtcagtgccaacgcgcttgctgtcacgggcctggggtcgcctcaatcaggtggagctgccacactggctgcgcaggcccgtctacagcctgtacatctggacgtttggggtgaacatgaaagaggccgctgtggaggacctgcatcactaccgcaacctcagcgagttcttccggcgcaagctgaagccgcaggcccggcctgtctgtggcctgcacagcgtgattagcccatcggatggaaggatcctcaactttgggcaggtgaagaactgtgaggtggagcaggtaaagggggtcacctactccctggagtcgttcctgggcccgcgtatgtgcacagaggacctgcccttcccaccagccgcgtcgtgtgactccttcaagaaccagctggtcacccgggaagggaatgagctctatcactgtgtcatctacctggcccctggggactaccactgcttccactcccccaccgactggactgtgtcccaccggcgccacttcccaggctccctgatgtcagtgaaccctggcatggctcgctggatcaaagagctcttctgccataacgagcgggtggtcctgacgggggactggaaacatggcttcttctcactgacagctgtgggggccaccaacgtgggctccattcgcatctactttgaccgggacctgcacacaaacagcccaaggcacagcaagggctcctacaatgacttcagcttcgtgacgcacaccaatagagagggcgtccccatgcgtaagggcgagcacctgggcgagttcaacctgggctccaccatcgtgctcatcttcgaggcccccaaggacttcaatttccagctgaaaacaggacagaaaatccgctttggggaagccctgggctcgctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - macrophage erythroblast attacher
- TSC22 domain family, member 4
- TSC22 domain family, member 4
- TSC22 domain family, member 4

Buy PISD-phosphatidylserine decarboxylase Gene now

Add to cart